Labshake search
Citations for Millipore Sigma :
601 - 650 of 10000+ citations for 6 Chloro N 5 ethoxy 1H pyrazol 3 yl 3 nitropyridin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: 8-(tri-fluoromethyl)-1,2,3,4,5-benzopentathiepin-6-amine hydrochloride (TC-2153 (Sigma-Aldrich)) or vehicle (5% DMSO in saline ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were cultured in medium supplemented with 2 mM 3-phosphoglycerate (3-PG, Sigma-Aldrich, #P8877) or 2 mM serine (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... and spinal cords of both sexes (n = 3 each) were fixed in 4% PFA and embedded in 5% agarose (Type IX-A; Sigma-Aldrich) supplemented with 20% sucrose ...
-
bioRxiv - Molecular Biology 2019Quote: ... or MG132 (10 μM, 2 h, replicates 2, 3, 4; Sigma). Proteins were precipitated in acetone ...
-
bioRxiv - Microbiology 2019Quote: ... A 200 μL aliquot of a solution containing 100 μg/μL of XTT (2, 3-(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide) (Sigma-Aldrich, St Louis, MO, USA) and 10 μg/μL of PMS (phenazine methosulfate ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Cell Biology 2021Quote: ... Complementary guide oligonucleotides (forward: 5’-CACCGCAGGATTGAAGACCTTAACA-3’; reverse: 5’-AAACTGTTAAGCTCTTCAATCCTGC-3’) were custom synthesized separately by Sigma-Aldrich (St. Louis, MO, USA), annealed ...
-
bioRxiv - Biophysics 2021Quote: ... The primers used for the same were a) A350P forward 5’-gctgcatccggccgcatctcggc-3’ and b) A350P reverse 5’-gccgagatgcggccaaggatgcagc-3’ (Sigma Aldrich, India). Full length A350P was thereafter cloned into an empty pEGFP (Clontech ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Bioengineering 2023Quote: ... and blocked for 1h with 3% goat serum and 1% BSA in PBS/0.25% Triton X-100 (Sigma). The primary antibodies were incubated overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mg of proteins were subsequently incubated for 1h with 10 μl of FAM134B or FAM134C antibodies (Sigma Prestige-HPA012077 and -HPA016492 ...
-
bioRxiv - Neuroscience 2024Quote: D1R agonist 2,3,4,5,-tetrahydro-7,8-dihydroxy-1-phenyl-1H-3-benzazepine hydrochloride (SKF38393; Sigma-Aldrich, St Louis, MO) was dissolved in sterile saline at a concentration of 0.5 μg/μL ...
-
bioRxiv - Cell Biology 2022Quote: ... BubR1 5’GAUGGUGAAUUGUGGAAUAdTdT3’) or luciferase (5’ CGUACGCGGAAUACUUCGAdTdT 3’) was synthesized from Sigma and used for the RNAi.
-
bioRxiv - Neuroscience 2021Quote: ... 5 μM carbonyl cyanide 3-chlorophenylhydrazone (Sigma Cat # C2759) and 5 μM valinomycin (Sigma Cat # V0627) ...
-
bioRxiv - Genomics 2021Quote: ... a 3-day puromycin (5 μg/mL, Sigma, P8833) selection was performed 48 hours after the spin-inoculation ...
-
bioRxiv - Biophysics 2020Quote: ... mglBΔCT-R (5’-CGTAAAGCTTTTACACCAGGCTCTCGAAGATCTTCGTGAGCTC-3’ synthesized by Sigma-Aldrich, India ...
-
bioRxiv - Cell Biology 2019Quote: The Cy®3 Mono 5-pack kit (Sigma) was used for the labeling of PROTAMINE ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA Piezo1 (Sigma-Aldrich: 5’-GCAAGUUCGUGCGCGGAUU[dT][dT]-3’), ON-TARGET plus SMARTpool human siRNA ADAM10 (Dharmacon) ...
-
bioRxiv - Neuroscience 2021Quote: ... or non-targeting siLUC (5’-UAAGGCUAUGAAGAGAUAC-3’, Sigma-Aldrich) were mixed with 54 μl of RNAiMAX (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... Forward siRNA sequences 5’-CAGUGGCAGUGGACAAUUCA[dT][dT]-3’ (Sigma) and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the siRNA duplex 5′-UUCUCCGAACGUGUCACGUdTdT-3′ (Sigma). The cells were further processed according to the experimental design and depletion was assessed by immunofluorescence ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 nM Rab14 siRNA (5′-CAACUACUCUUACAUCUUU-3′, Sigma-Aldrich) for 72 h using Lipofectamine 2000 ...
-
bioRxiv - Genetics 2023Quote: ... scrambled (NT) shRNA (5’-GCGATAGCGCTAATAATTT-3’ SHC202; Sigma-Aldrich) or a shRNA specific for human SOX11 (100% identity to the equine SOX11 sequence ...
-
bioRxiv - Genetics 2024Quote: ... moxidectin (3 nM) (Millipore Sigma, Catalog # 113507-06-5), ricobendazole (25 μM ...
-
bioRxiv - Immunology 2021Quote: Blood was extracted from hBLT mice at 3 and 5-6 weeks post-infection and lysed with Red Blood Cell Lysis Buffer (SIGMA). T cells were activated for 1.5 h with 5μl/ml of anti-CD28 and anti-CD49d in the presence or absence of 6.4μg/ml of a Gag pool of peptides in the presence of 0.5μg/ml Brefeldin A ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then treated with 6-thio-dG (3-5 μM) in the presence of 500 ng/ml doxycycline (Sigma), washed three times with warm PBS and allowed to recover in regular growth medium containing 500 ng/ml doxycycline ...
-
bioRxiv - Neuroscience 2022Quote: ... mito-tempol[23] (25 μg, Sanbio) and oligodeoxynucleotide (3 μg/μl day 4, 5 and 6 after carrageenan, Sigma-Aldrich), were performed under light isoflurane anesthesia as described.[8a ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μl of 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT, 0.5 mg/ml in PBS, Sigma-Aldrich, USA) with 1 μM of menadione (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reactions were quenched by adding 5 mM ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) (Sigma-Aldrich, E3889) and pelleted afterwards ...
-
Methacrylic acid-based biomaterials promote peripheral innervation in the subcutaneous space of micebioRxiv - Bioengineering 2022Quote: Some mice (N=3) were administered the IGF-1 inhibitor Tyrphostin AG1024 (Sigma) daily beginning on the day of hydrogel implantation for 21 days ...
-
bioRxiv - Molecular Biology 2022Quote: ... Coverslips were mounted on slides using 3% (w/v) n-propyl gallate (Sigma) in an 80% glycerol solution and sealed with clear nail varnish ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-indolylacetyl)-DL-aspartic acid (IAA-Asp; Sigma-Aldrich, St. Louis, MO), (+/-)-jasmonic acid (JA ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 0.17mg/ml tricaine (ethyl-3-aminobenzoatemethanesulfonate, ref. n°E10521, Merck/Sigma-Aldrich). WM983B cells of different lysosome clustering status (spread ...
-
bioRxiv - Synthetic Biology 2023Quote: 3-O-C6-HSL (N-(B-Ketocaproyl)-L-Homoserine Lactone from Sigma-Aldrich, cat # K3007 ...
-
bioRxiv - Microbiology 2024Quote: ... 30 mM 3-(N-Morpholino)propanesulfonic acid (MOPS) (Sigma-Aldrich, Product No. 69947) was used as a buffering agent at pH at 7 during the experimental time course ...
-
bioRxiv - Immunology 2022Quote: ... and mesenteric) (n=3) were pooled in digestion medium consisting of RPMI 1640 with 2% fetal bovine serum (FBS) (Sigma-Aldrich), deoxyribonuclease (DNase ...
-
bioRxiv - Microbiology 2022Quote: ... 3-(N-Morpholino)propanesulfonic acid (MOPS) or 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES) buffer (all purchased from Sigma-Aldrich, USA). Macrocolonies were excised and resuspended in 2 mL of sterile 1X PBS ...
-
bioRxiv - Neuroscience 2020Quote: PF-4778574 [N-<(3R,4S)-3-[4-(5-cyano-2-thienyl)phenyl]tetrahydro-2H-pyran-4-yl>propane-2-sulfonamide] was obtained as a powder from Sigma (catalog #PZ0211) and solubilized (2.5 mg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... asynchronously growing subconfluent cells were labeled with 30 μM thymidine analogue 5-chloro-2’-deoxyuridine (CIdU) (#C6891, Sigma-Aldrich) for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... and pMCAo-21d group received 4 intraperitoneal injections of 50 mg/kg of 5-Chloro-2′-deoxyuridine (CldU, Sigma). The injections were administered 6 ...
-
bioRxiv - Microbiology 2020Quote: Laurdan (6-Dodecanoyl-N, N-dymethyl2-naphthylamine, Sigma-Aldrich) was used to detect the liquid ordering in the membrane ...
-
bioRxiv - Biochemistry 2021Quote: ... and N,N-diisopropylethylamine (DIPEA, 6 eq, Sigma-Aldrich) and coupled to the deprotected α-amine on resin for 30 minutes at 25 °C in DMF while bubbling with nitrogen gas ...
-
bioRxiv - Microbiology 2022Quote: ... and 20 uL of 120 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (Pierce; dissolved in 47% ACN, 47% water and 6% HPLC-grade pyridine (Sigma Aldrich)) were added ...
-
bioRxiv - Biophysics 2022Quote: ... SPR2 DNA encoding residues 649-864 was generated using the polymerase chain reaction method (primers: 5’-GGCAGGACCCATATGGGCAGGAGAGGGTGGGATAATAAAGC-3’ and 5’-GCCGAGCCTGAATTCTTACTTGTCGAACTGTTGGAGATCGATTTC-3’) and individually sub-cloned into pET28 (Millipore Sigma, Burlington, MA) using engineered NdeI and EcoRI restriction endonuclease sites ...
-
bioRxiv - Genetics 2022Quote: ... Slides were then rinsed in washing buffer five times for 3 min each and nuclei were stained with 4lr,6-diamidino-2-phenylindole (DAPI, cat # D-1388, Sigma) at a concentration of 1 μg/ml for 10 min at RT ...