Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 6 Chloro N 5 ethoxy 1H pyrazol 3 yl 3 nitropyridin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Biochemistry 2022Quote: ... D-glucose N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP) and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich, USA ...
-
Proteasome granular localization is regulated through mitochondrial respiration and kinase signalingbioRxiv - Cell Biology 2022Quote: ... and 2-[2-(3-chlorophenyl)hydrazinylidene]-propanedinitrile (CCCP) (Sigma), were used at final concentrations of 0.5 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-[2-(3-chlorophenyl)hydrazinylyidene]propanedinitrile (CCCP) (Sigma-Aldrich), rhodamine 123 ...
-
bioRxiv - Microbiology 2021Quote: 5-aza-2’-deoxycytidine (5-AzadC, A3656) and epigallocatechin-3-gallate (EGCG, E4143) were purchased from Sigma Aldrich. Antibodies against CREB (sc-186) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) for 15 min at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-fenylindol (DAPI; 1:10 000; Sigma-Aldrich, Saint-Louis, MO, USA, 28718-90-3) and phosphate buffer (PB ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-fenylindol (DAPI; 1:10 000; Sigma-Aldrich, Saint-Louis, MO, USA, 28718-90-3) and phosphate buffer (PB ...
-
bioRxiv - Molecular Biology 2021Quote: ... USA) and benznidazole (N-benzyl-2-nitro-1H-imidazole-1-acetamide) were from Sigma (St. Louis, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were then incubated for 2 hours with 3 µg/ml 5-bromo-2’-deoxyurine (Sigma-Aldrich, B5002). Cells were then detached using trypsin/EDTA (GIBCO ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: A total of 150 µL of 3% 4-ethoxymethylene-2-phenyl-2-oxazolin-5-one (oxazolone; Sigma-Aldrich) dissolved in 100% ethanol (Wako ...
-
bioRxiv - Plant Biology 2019Quote: ... Labeled standards for indole-3-acetic acid and N-(3-indolylacetyl)-DL-aspartic acid were obtained from Sigma-Aldrich. Calibration curves were linear (r values = >0.99 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 mM 4-MU N-acetyl-β-D-glucosaminide (Sigma Aldrich) in 200 mM sodium citrate buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and N-(3-Oxooctanoyl)-L-homoserine lactone (3OC8-HSL, O1764, Sigma) for the tra system.
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mM 4-MU N-acetyl-β-D-glucosaminide (Sigma Aldrich) in 200 mM sodium citrate buffer ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: HemEC (n=3) were transduced with SOX18 shRNA lentivirus (TRCN0000017450, Sigma) or an empty vector control virus (Sigma SHC001V ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’-GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’-AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Bioengineering 2020Quote: ... in 1x PBS and exposed for 1h to a 3% Bovine Serum Albumin (BSA, Sigma Aldrich) blocking solution in 1x PBS.
-
bioRxiv - Microbiology 2021Quote: ... A carboxylated indene standard (1H-Indene-3-carboxylic acid) was purchased from Sigma-Aldrich (catalog #MNO000013). Hexanes and acetone (Fisher) ...
-
bioRxiv - Biophysics 2020Quote: ... Blebbistatin 5 μM 1h (Sigma Aldrich), Latrunculin A 0.12 μM 2h45 (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: The mice received three injections every 2 h (200 ul/injection, intraperitoneally in alternative sites of the body) of 5-Chloro-2’-deoxy-Uridine (CldU, Sigma reference C6891 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Biochemistry 2023Quote: ... and eluted with Cas1-2/3 Lysis Buffer containing 3 mM desthiobiotin (Sigma-Aldrich). Eluate was concentrated at 4°C (Corning Spin-X concentrators) ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA was crosslinked to the membrane in 0.16 M N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (Sigma) in 0.13 M 1-methylimidazole (Sigma) ...
-
The cellular basis of protease activated receptor type 2 (PAR2) evoked mechanical and affective painbioRxiv - Neuroscience 2020Quote: ... and 3 ug/ml 5-fluoro-2’-deoxyuridine + 7 ug/ml uridine (FRD+U; Sigma) added ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 μg/mL + 7 μg/mL FRD+U (5-Fluoro-2′-deoxyuridine, Sigma-Aldrich, Cat# F0503 and Uridine ...
-
bioRxiv - Neuroscience 2024Quote: ... 2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (cAMP; 50 μM, Millipore Sigma, D0627), and cis-4 ...
-
bioRxiv - Cell Biology 2020Quote: ... sodium-3-methyl-2-oxobutyrate (ketovaline, Sigma), 3-methyl-2-oxovaleric acid sodium salt (ketoisoleucine ...
-
bioRxiv - Developmental Biology 2020Quote: ... phosphatase inhibitor cocktail 2 and 3 (Sigma), and cOmplete EDTA-free protease inhibitor cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2-3 mL mineral oil (M8410, Sigma) was used to fully overlay the droplets to prevent the evaporation.
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM Mg(Ace)2 (Sigma #63052), 10mM Tris-HCl (pH 8 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM Mg(Ace)2 (Sigma #63052), 10mM Tris-HCl (pH 8 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM Mg(Ace)2 (Sigma #63052), 10mM Tris-HCl (pH 8 ...
-
bioRxiv - Microbiology 2020Quote: ... indole-3-actic acid (Sigma, 2 mM) were freshly prepared for serial dilutions (10x ...
-
bioRxiv - Neuroscience 2022Quote: ... phosphatase inhibitor cocktails 2 and 3 (Sigma). Lysates sat on ice for 30min with intermittent vortexing ...
-
bioRxiv - Bioengineering 2021Quote: ... + 0.05 × 10−3 M 2-mercaptoethanol (Sigma)] supplemented with soluble anti-mouse CD28 (5 µg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-methylene-2-norbornanone (Sigma; Cat# M46055), lumiflavin (Cayman Chemical ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% 2-ethyl-3-methylpyrazine (Sigma W315508), 1% 2,5-dimethylpyrazine (Sigma 17542015) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 1% phosphatase inhibitor cocktail 2 & 3 (Sigma) and protease inhibitor cocktail ...
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... phosphatase inhibitor cocktail 2 and 3 (Sigma) and benzonase (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and phosphatase inhibitors 2 and 3 (Sigma). Lysates incubated on ice for at least 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... β2/3 subunit (Millipore, catalog #: 05-474) (1:250 dilution) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... N-diisopropyl ethyl amine were purchased from Sigma Aldrich (St. Louis, MO). HPLC grade acetonitrile was purchased from Supelco (Bellefonte ...
-
bioRxiv - Plant Biology 2020Quote: ... PGM buffer (6% mannitol, 3% sucrose, M5524 MS salts (Sigma), M7150 vitamins (Sigma) ...