Labshake search
Citations for Millipore Sigma :
6351 - 6400 of 10000+ citations for 6 4 Methyl 1 piperazinyl N 5 methyl 1H pyrazol 3 yl 2 1Z 2 phenylethenyl 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 2 µM nocodazole (Sigma) was added 2 h before fixation ...
-
bioRxiv - Neuroscience 2024Quote: ... 1X P/S (Gibco),100μM 2-Mercaptoethanol (Sigma). From day 35 to day 56 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2% glutaraldehyde (Sigma) in 0.1M phosphate buffer pH 7.4 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 CaCl2 (Sigma-Aldrich), and 4 MgCl2 (Carl Roth ...
-
bioRxiv - Microbiology 2024Quote: ... 2 mM glutamine (Sigma), and 10 μg/mL gentamicin (Thermo Fisher) ...
-
bioRxiv - Microbiology 2024Quote: ... 2′-bipyridyl (Sigma-Aldrich). Mycobactin J was obtained from Allied Monitor (USA) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 3-MA (M9281, Sigma), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... 3-Methyladenine (5 mM, Millipore Sigma, M9281), lactostatin (1 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 μL N,N,N′,N′-tetramethylethylenediamine (TEMED) (Sigma), 20 μL bis-acrylamide 2% (BioRad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... N,N,N’,N’-Tetramethylethylenediamine (TEMED; T9281, Sigma-Aldrich), Ammonium persulfate (A3678 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 0.75 µl N,N,N′,N′-tetramethylethylenediamine (Sigma) were added into 0.5 ml mixtures ...
-
bioRxiv - Plant Biology 2023Quote: ... N,N,N’,N’-Tetramethylethylenediamine (TEMED) (Sigma, T7024-25ML), NaCl (5 M ...
-
bioRxiv - Systems Biology 2023Quote: ... 6 M Urea and 1% Sodium Dodecyl Sulphate supplemented with 100mM phenylmethylsulfonyl fluoride and 1% phosphatase inhibitor cocktail 3 (Sigma-Aldrich)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... ruxolitinib in 100% DMSO was added to 5% N,N-dimethylacetamide (Cat # D137510-500ml, Sigma Aldrich, St. Louis, MO) + 0.5% methylcellulose (Cat # ME136 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 140 and 400 bp with 5’ ends labelled with 6-carboxyfluorescein (6-FAM) and tetramethylrhodamine (TAMRA) were amplified using primers (synthesized from Sigma-Aldrich, supplementary table 1) and incubated with gp275 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pregnant females were injected intraperitoneally at E12.5 with 75 μg/g 4-hydroxytamoxifen (4-OHT; Sigma-Aldrich #H6278) dissolved in corn oil ...
-
bioRxiv - Neuroscience 2021Quote: ... The experimental mice were injected intraperitoneally with 4-Hydroxytamoxifen (4-OHT) (Sigma Aldrich; Cat.#:H6278-50mg; 75mg/kg) once per day during 4 consecutive days ...
-
bioRxiv - Developmental Biology 2019Quote: ... 10 mL of Working Hanks 4 (WH4; 1X HBSS/4 g/L total glucose/1X antibiotic-antimycotic (Sigma)) was added ...
-
bioRxiv - Pathology 2022Quote: ... in PBS, 2x) and soaked in 12.5% (2h; 4°C) and 25% (7 days, 4°C) sucrose (Sigma). Kidneys were embedded in OCT (Tissue-Tek® ...
-
bioRxiv - Bioengineering 2022Quote: ... The PEG pre-polymer phase comprised 27.5% w/v 5kDa 4-arm PEG acrylate (Advanced BioChemicals) with 4% w/v lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP, Sigma) in phosphate buffered saline (PBS ...
-
bioRxiv - Cancer Biology 2022Quote: U2OS cells were grown on 4 well glass slides (Millicell EZ SLIDE 4 well glass, Millipore Sigma PEZGS0416). After washing three times in 1× PBS (pH 7.4) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pregnant females were injected intraperitoneally (i.p.) with 10 mg/kg 4-hydroxytamoxifen (4-OHT, Millipore-Sigma cat #H6278) dissolved in corn oil (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pregnant females were injected intraperitoneally (i.p.) with 10 mg/kg 4-hydroxytamoxifen (4-OHT, Millipore-Sigma cat #H6278) dissolved in corn oil (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... in addition to the corresponding drug treatment: either 4-hydroxytamoxifen (4-OHT; Sigma Aldrich; stock concentration: 13 mM) or its vehicle ...
-
bioRxiv - Physiology 2022Quote: ... The soluble material was incubated for 4 hours at 4°C with anti-Flag M2 magnetic beads (Sigma). Beads was washed with buffer containing 20 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2021Quote: ... The pTriEx-4 Ek/LIC hTG4 vector was constructed using pTriEx™-4 Ek/LIC Vector Kit (Novagen) based on the manufacturer instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... Setd2flox/flox MEFs expressing ER-Cre were treated with 3μM (Z)-4-hydroxytamoxifen (4-OHT, Millipore Sigma, H7904) or vehicle (Ethanol ...
-
bioRxiv - Physiology 2023Quote: ... supplemented with protease inhibitors (4 μM PMSF, 20 μg/ml Pepstatin A, 4 μg/ml Leupeptin) (Sigma Aldrich), 5 μg/mL DNase and 10 μg/ml RNAse (Sigma Aldrich) ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were then exchanged into the NMR buffer using Amicon Ultra-4 centrifugal concentrators (4 mL; Millipore Sigma) with a 3-kDa molecular cutoff to a final volume of ∼250 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... 4% formaldehyde solution in 0.1 M PBS at around 4°C (Sigma Aldrich Inc., St. Louis, MO, USA) for cryoprotection for about 7-14 days ...
-
bioRxiv - Bioengineering 2024Quote: ... 0.5 mM 4-Methylumbelliferone (4-MU, Selleckchem, in 0.1% v/v DMSO) and 0.1 mM Glycyrrhizin (Sigma-Aldrich) added to the culture media for 3 days (0.1% v/v DMSO and DMEM were used as a controls) ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with protease inhibitors (4 μM PMSF, 20 μg/mL Pepstatin A, 4 μg/mL Leupeptin; Sigma Aldrich), 5 μg/mL DNase and 10 μg/mL RNase (Sigma Aldrich) ...
-
bioRxiv - Bioengineering 2021Quote: ... The yeasts were grown in yeast extract (1%, w/v) peptone (2%, w/v) glucose (2%, w/v) (YPD) media supplemented with 50mg/L ampicillin (Sigma-Aldrich, 69534). The strains were grown in 250 mL Erlenmeyer flasks containing 100 mL of YPD ...
-
bioRxiv - Molecular Biology 2020Quote: ... sections of mouse heart were perfused for 1-2 min with 2ml of 2% TTC (Sigma-Aldrich Co., St. Louis, MO, USA) in phosphate-buffered saline (PBS ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast cells were grown in rich medium (YPD; 1% yeast extract [Difco, 10215203], 2% peptone [Difco, 211705], and 2% glucose [wt/vol]) (Sigma-Aldrich, G7021) on an orbital shaker (200 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... were resuspended 2 mL of viral particle supernatant for E:T of 2:1 with 8 μg/mL of Polybrene (Millipore Sigma, Burlington, MA), maintained in at 37°C for 4 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... the carboxylic acid groups on the Dynabeads® were activated by a 30-minute incubation with N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide (EDC, cat. num. 39391, Sigma) and N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Carboxyl groups on the photo-activated regions were activated with 50 µL/well of 0.05 g/mL N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (Sigma-Aldrich, 03450) and N-Hydrosuccinimide (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... after which the rats in the ACTH group (n=50) were administered with either 3 injections of imipramine (n=10) (IMI, 15 mg/kg i.p. (Sigma-Aldrich, Denmark)) or 1 injection of saline ...
-
bioRxiv - Molecular Biology 2024Quote: ... N-(4-ethylphenyl)-2-[[4-ethyl-5-(3-pyridinyl)-4H-1,2,4-triazol-3-yl]thio}acetamide (ORco Receptor Agonist ORcoRAM2; OA) from Asinex Corporation and Vitas M Chemical Ltd; N,N-diethyl-3-methylbenzamide (DEET; V) from Sigma-Aldrich; and coelenterazine from Biosynth ...