Labshake search
Citations for Millipore Sigma :
6051 - 6100 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were lysed in the presence of 50 mM N-ethylmaleimide (NEM) (Sigma) with lysis buffer containing 1% IGEPAL (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... GECs were additionally treated with N-acetyl Cysteine (NAC) (50 uM, Millipore Sigma, A9165) for 1 h and/or eATP (3mM ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cultures were supplemented with N-acetylneuraminic acid (neuraminic acid, Neu5Ac; Sigma, St. Louis, MO) at a 1 mM concentration unless otherwise indicated.
-
bioRxiv - Biochemistry 2021Quote: ... Per experimental setup, the media was either supplemented with L-lysine-2H4 and L-arginine-13C6-14N4 (named as Lys4, Arg6) (Sigma-Aldrich, St. Louis, MO), L-lysine-13C6-15N2 and L-arginine-13C6-15N4 (named as Lys8 ...
-
bioRxiv - Biochemistry 2021Quote: ... titration was performed with pre-titrated bovine trypsin and Nα-benzoyl-L-arginine 4-nitroanilide hydrochloride (L-BAPA; Sigma-Aldrich, St. Louis, MO, USA), as described previously 44 Briefly ...
-
bioRxiv - Immunology 2021Quote: ... To avoid bacterial infections mice received antibiotics-containing drinking water (2 g/l neomycin sulfate, 100 mg/l polymyxin B sulfate; Sigma-Aldrich, St. Louis, MO) for the first 5 days after infection ...
-
bioRxiv - Physiology 2022Quote: ... Diet composition: Supplemental Tables 1A and 1B) and L-nitroarginine methyl ester (L-NAME, 1 mg/ml, Cat #N5751, Sigma Chemical, St Louis, MO) in the drinking water ...
-
bioRxiv - Systems Biology 2022Quote: ... Two drops (5μl and 0.3μl) of premixed 3x Tribolium saline + Schneider’s solution (1:1) supplemented with 100 μmol l-1 of amaranth (Sigma-Aldrich, St Louis, MO, USA) were dropped under paraffin oil and their circumference measured by formula using the eye-piece graticule (10 mm = 200 parts ...
-
bioRxiv - Neuroscience 2023Quote: To identify the number of lipid droplets (LDs), cells were stained with Lipi-red (Dojindo, Japan; 1 umol/L) and Hoechst solution (Sigma, USA; 1 umol/L). Live cells were imaged under a confocal light microscopy (Ti-RCP ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... HEK-G551D-CFTR were seeded at 40000 cells/well into 384-well black clear bottom plates coated with 0.01% Poly-L-Lysine (Poly-L-Lysine, Sigma-Aldrich, #P8920, 0.1 % (w/v) diluted 1:10 in PBS- ...
-
bioRxiv - Molecular Biology 2021Quote: ... SC-His+3AT is minimal medium of SC-His supplemented with 3-aminotriazole (3-AT, 0.5mM, Sigma-Aldrich).
-
bioRxiv - Plant Biology 2019Quote: ... The transformants were then spotted on SD (-Trp -Leu -His) selection media containing 0.5/1mM 3-Amino-1,2,4-triazole (3-AT; Sigma, A8056). The positive interactors were then scored based on the stringency of the selection.
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3-Amino-1,2,4-triazole (3-AT) (≥95% TLC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Z-VAD-FMK ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 3 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s complete adjuvant (Sigma-Aldrich) for priming ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM of 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide HCl (EDC, 22980-Sigma-Aldrich, St. Louis, MO, USA) and 5 mM of N-hydroxysulfosuccinimide sodium salt (NHS ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2022Quote: ... SM and trunSM (tissue lysates) and 14-3-3 was performed using Immobilon Western chemiluminescent HRP substrate (Millipore) and an ImageQuant LAS 500 imager (Cytiva Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and HRP-conjugated Anti-Rabbit IgG Secondary Antibody) and R&D Systems/Minneapolis/MN (14-3-3-Sigma polyclonal goat IgG and HRP-conjugated Anti-Goat IgG Secondary Antibody) ...
-
bioRxiv - Plant Biology 2024Quote: ... Bromo-4-Chloro-3-Indolyl a-D-galactopyranoside (X-a-gal) and 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma). The plates were imaged after 60-72 incubation at 28°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... were washed three times with 3 ml of water using Amicon Ultra-4 (3 kDa cut-off, Millipore) (centrifugation at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The staining was revealed by exposure to 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: 3 dpf larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich) and caudal fin transection was performed11 30 minutes prior to imaging ...
-
bioRxiv - Zoology 2023Quote: ... The concentrations used were 15.62 x 10-3 mg and 31.25 x 10-3 mg of capsaicin (CAS 4004-86-4 Sigma) per gram of body mass ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from testis tissues (3 WT versus 3 Clpp-null)) with TRI reagent (Sigma-Aldrich), and reverse transcription was done with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... and filtered through a 3-kDa molecular filter (Amicon® Ultra Centrifugal Filter, 3 kDa MWCO, Millipore Sigma) at 4°C for 90 minutes to remove proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Plant Biology 2020Quote: ... and 20mg/L (w/v) peroxidase from horseradish (Sigma-Aldrich) with 100nM flg22 only ...
-
bioRxiv - Plant Biology 2020Quote: ... supplemented with 2 mg/L 6-Benzylaminopurine (Sigma, Cat. #B3408) and 1 mg/L ABA (Phytotech ...
-
bioRxiv - Biophysics 2021Quote: ... 2 g/l of U-[2H] D-glucose (Sigma Aldrich) was used as carbon source ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 2000 mg/L D-glucose (Cat# G54000, Sigma-Aldrich) ± erastin2 (1 μM) ...
-
bioRxiv - Cell Biology 2020Quote: l-DOPA was added to the media (1mM, Sigma Aldrich) with retinal organoids on D29 and removed after 12h by changing the media ...
-
bioRxiv - Cell Biology 2020Quote: ... and 213μg/ml L-ascorbic acid 2-phosphate (Sigma-Aldrich), with 6 μM CHIR 99021 (Selleck Chemicals ...
-
bioRxiv - Cell Biology 2020Quote: 15,000 U87MG cells were plated on poly-L-Lysine (Sigma) treated Seahorse XF96 Cell Culture Microplates (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... in 200 mg/L of MS-222 (Sigma, MO, USA), fixed for 72 hours in 10% neutral buffered formalin and decalcified in 0.5MEDTA for 48 h ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 2 mM L-glutamine (Sigma-Aldrich, Gillingham, UK), 6.25 μg/ml adenine ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 2 mM L-glutamine (Sigma-Aldrich, Gillingham, UK), 0.25 μg/ml adenine ...
-
bioRxiv - Cell Biology 2020Quote: ... resuspended in 1:1000 poly-L-lysine (Sigma-Aldrich, P4707) in PBS and incubated for 10 minutes at RT ...
-
bioRxiv - Immunology 2021Quote: ... and metronidazole (1 g/L) (Sigma-aldrich, St. Louis, MO) and administered ad libitum using drinking bottles ...
-
bioRxiv - Microbiology 2019Quote: ... GSH (L-Glutathione reduced form, Sigma; final concentration 100 μM), AsA (L-ascorbic acid ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Protein expression was induced with 0.1% L-arabinose (Sigma-Aldrich). Expression took place for 16 h at 15°C and 220 rpm ...
-
bioRxiv - Immunology 2020Quote: ... Mice were pre-treated with 750 mg/L metronidazole (Sigma) in 2.5% sucrose drinking water for 4 days as previously described64 ...
-
bioRxiv - Developmental Biology 2021Quote: ... supplemented with 280 mg/L methylene blue (Sigma-Aldrich, M4159). For experiments ...
-
bioRxiv - Developmental Biology 2021Quote: ... NS cells were grown on poly-L lysine (Sigma, #P8920) treated coverslips with thickness #0 (VWR ...
-
bioRxiv - Neuroscience 2022Quote: ... coverslips were first coated with Poly-L-ornithine (Sigma Aldrich) for 1 hour at 37°C and then overnight with Laminin (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1% L-glutamine (v/v) (Sigma Aldrich®, G7513). Cells were cultured at 37°C in a humidified atmosphere containing 5% CO2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adult Worm Media: DMEM (5.4 g/L D-Glucose, Sigma) supplemented with Antibiotic Antimycotic (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and 50 µl L-cysteine [152.2 mM] (Sigma C-1276). Papain solution was then placed for 15 minutes in a tabletop spinning incubator preheated to 34°C spiining at 10 RPM ...
-
bioRxiv - Neuroscience 2021Quote: ... and L-ascorbic acid (200 µM) (Sigma-Aldrich, MO, USA). For neuronal stimulation ...
-
bioRxiv - Cell Biology 2022Quote: ... and plated onto poly-L-lysine (0.005 % w/v, Sigma) and laminin (4 µg/ml ...