Labshake search
Citations for Millipore Sigma :
5951 - 6000 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Bioengineering 2020Quote: ... we added 200 μL of a freshly made 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma-Aldrich) solution 2% w/v (corresponds to 10 mg EDC in 500 μL MES buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Bioengineering 2020Quote: ... pH 5.8 and reacted with 600 molar excess of 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and 200 molar excess racemic aminomethylnicotine for 20h ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coupled with the Supelco Discovery HS F5-3 HPLC column (150 ×2.1 mm × 3 µm) (Sigma Aldrich). Mobile phase A consisted of 10 mM ammonium formate ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were placed into a diaminobenzidine (DAB) solution in dH20 (Sigma-Aldrich Fast 3–3’ Diaminobenzidine Tablets) for 2 minutes and then rinsed thoroughly with TBS to prevent further DAB reactions ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrated to ∼3 mg/mL using Amicon Ultra centrifugal filter (3 kDa molecular weight cut-off) (Millipore) and loaded onto the size-exclusion Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Systems Biology 2022Quote: ... 3 ml of supernatant were homogenized with 3 ml of ethyl acetate (Millipore Sigma, item number 270989). Organic and aqueous layers were separated by centrifugation at 3 ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μl of 3 μM TO-PRO-3 or 50 μl 10 μg/mL DAPI (Sigma D9542) in PBS was added ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg of protein from each sample were incubated with 3 ug of HOXA9 (Millipore # 07-178) or Rabbit IgG Isotype control (Invitrogen # 02-6102 ...
-
Phenotypic and molecular evolution across 10,000 generations in laboratory budding yeast populationsbioRxiv - Evolutionary Biology 2020Quote: ... We spotted the entire volume of each of the other 88 wells on CSM-Arg (Sunrise Scientific) plates supplemented with 100 mg/L L-canavanine (Sigma-Aldrich, St. Louis). Plates were allowed to dry overnight at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... For counter-selection plates, LB-no salt (10 g/L tryptone, 5 g/L yeast extract) containing 20% (w/v) sucrose (Sigma-Aldrich 84097-1KG), 15 g/L agar and 0.5 µg/ml anhydrous tetracycline (AHT ...
-
bioRxiv - Immunology 2022Quote: Lentiviral plasmids encoding shRNA for gene knockdown for PRDM1-L or open reading frame of overexpression for PRDM1-S and PRDM1-L were obtained from Sigma-Aldrich (MISSION shRNA) and Horizon Discovery Biosciences (Precision LentiORF) ...
-
bioRxiv - Genetics 2023Quote: ... UV-induced mutagenesis frequencies were obtained by dividing the number of colonies growing on synthetic plates without arginine and containing l-canavanine (Sigma, 30 mg/l) (i.e. ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.5mM of L-NAME (Nω-Nitro-L-arginine methyl ester hydrochloride) was added to cell cultures (Sigma, St. Louis, MO, USA, Cat. # N5751). L-arginine ...
-
bioRxiv - Physiology 2024Quote: ... the medium was replaced with fresh ECGM2 containing sepiapterin (10 µmol/L) and propidium iodide (10 µmol/L) (Cat. # P4170; Sigma-Aldrich, Darmstadt, Germany). Cells were then treated with either solvent ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 μl of N,O-Bis(trimethylsilyl)trifluoroacetamide+1% trimethylsilyl (BSTFA+1% TMCS, Sigma) were added and incubated at 110 °C for 15 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Histones were extracted from nuclei by treatment with 0.4 N H2SO4 (Sigma 258105-500mL) for 30 minutes at room temperature and then precipitated from the supernatant by dropwise addition of ice-cold trichloroacetic acid (Sigma T069-100mL) ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 50 µM phenylmethysulfonyl fluoride (PMSF) and 50 µM N-methylmaleimide (all Sigma-Aldrich), then sonicated and 10% v/v β-mercaptoethanol added (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2022Quote: ... and glucose-6-phosphatase enzyme (catalog n°G8404, Sigma-Aldrich, Saint-Louis, MO, USA).
-
bioRxiv - Neuroscience 2019Quote: ... we also applied 5 mM QX-314 (Lidocaine N-ethyl bromide; Millipore Sigma, Canada) via the intracellular recording solution in order to block sodium (Salazar et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... we conducted intraperitoneal (IP) injection or cannula infusion of Clozapine-N-Oxide (CNO, Sigma) to inactivate infected neurons or terminals before behavioral testing ...
-
bioRxiv - Developmental Biology 2019Quote: ... S4 are anti human Tcf7l2 (N-20, SCBT) and anti-gamma tubulin (T9026, Sigma) HRP coupled secondary antibodies (1/2,000 ...
-
bioRxiv - Neuroscience 2019Quote: Female fly heads (10 per N) were collected and homogenized in RIPA buffer (Sigma). 4X SDS loading buffer was added ...
-
bioRxiv - Cancer Biology 2019Quote: ... Control extracts were also incubated with 50 mM N-Ethyl Maleimide (NEM; Sigma-Aldrich) to inhibit any UbL conjugation ...
-
bioRxiv - Biophysics 2021Quote: ... 8 mg/mL unlabelled tubulin was incubated with 1 mM N-ethyl maleimide (Sigma) on ice for 10 mins ...
-
bioRxiv - Biophysics 2021Quote: We did antibody labelling following commercial protocols for (+)-Biotin N-hydroxysuccinimide ester (H1759, Sigma) and Alexa Fluor™ 488 NHS Ester (A20000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Released N-glycans were labeled with 8-aminopyrene-1,3,6-trisulfonic acid (APTS, Sigma Aldrich), followed by a sample clean-up step (HILIC SPE ...
-
bioRxiv - Neuroscience 2020Quote: ... D2-ChR2 rats (n = 4) were anaesthetized with urethane (1.44 g kg−1, Sigma). The total dose was administered in three separate intraperitoneal injections ...
-
bioRxiv - Microbiology 2021Quote: ... A sample containing 0.5µg mRNA was applied directly onto the Hybond-N+ membrane (Millipore) and secured to the membrane by two treatment rounds in a HL-2000 HybrilinkerTM Hybridization Oven/UV Crosslinker (Analytik Jena US ...
-
bioRxiv - Microbiology 2020Quote: ... These S-o and S-n were cloned in to p3xFLAG-CMV-9 (Sigma) and pCMV3-SP-N-MYC (Sino Biological ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The final concentrations of drugs were: ATRA 0.1μM (cat n° R2625, Sigma-Aldrich Merck), SU5402 20μM (cat n° SML0444 ...
-
bioRxiv - Biochemistry 2022Quote: ... or after adding 6M Urea-d4 (98% atom D, Sigma Aldrich P/N 176087). Isotope pulse-labeling during refolding was performed with 0.2M Urea-d4 (pD 8.0 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mg/mL of N-hydroxysuccinimide (NHS) ester dye (Atto 488 NHS Ester, Sigma) was mixed with 50 mM borate buffer (pH 9 ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were mounted in 80% glycerol containing 20 µg/ml N-propyl gallate (Sigma) or Vectashield mounting medium (Vector Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... washed and then incubated with anti-GluA2 N-Terminal Antibody (MAB397, Millipore, 1:70) for 20 mins at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA from tail tips was isolated using Extract-N-Amp Tissue PCR kit (Sigma) and PCR genotyping undertaken as described (The Jackson Laboratory ...
-
bioRxiv - Neuroscience 2020Quote: ... The His-tag was removed by O/N incubation with TEV protease (Millipore Sigma) at 4 °C followed by negative INAC ...
-
bioRxiv - Microbiology 2020Quote: ... N gene of SGLV (GenBank accession number MT328777) was cloned into pET-30a (Novagen), and the resulting recombinant plasmid was transformed into Escherichia coli BL21 DE3 strain ...
-
bioRxiv - Immunology 2020Quote: ... The UGCG inhibitor N-Butyldeoxynojirimycin (NB-DNJ, Sigma Cat#B8299, CAS: 72599-27-0) was used at a final concentration of 10 µM ...
-
bioRxiv - Microbiology 2022Quote: ... mouse anti-OC43 N (CoV antibody, OC43 strain, clone 541-8F, Millipore-Sigma, MAB9012), rabbit anti-OC43 S (Cusabio ...
-
bioRxiv - Microbiology 2022Quote: ... mouse anti-OC43 N (CoV antibody, OC43 strain, clone 541-8F, Millipore-Sigma, MAB9012), rabbit anti-OC43 S (Cusabio ...
-
bioRxiv - Bioengineering 2022Quote: ... and N2 acrylic acid (0.1% w/v, acrylic acid-N-hydroxysuccinimide ester, A8060, Sigma) were successively added and mixed by vortexing ...
-
bioRxiv - Microbiology 2022Quote: ... coli BL21(DE3) as a fusion protein containing an N- terminal His6-tag (Novagen) and purified by metal-affinity chromatography (Ni-NTA ...
-
bioRxiv - Plant Biology 2019Quote: Melatonin (N-acetyl-5-methoxytryptamine) was obtained from Sigma-Aldrich (St. Louis, MO, USA). All other reagents were obtained from Sinopharm Chemical Reagent Beijing Co. ...