Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for 7 Chloro 1 3 dihydro imidazo 4 5 c pyridin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... for 15 min and blocked for 2 h at room temperature or overnight at 4°C using 2% BSA (Bovine Serum Albumin, Sigma). Samples were incubated with respective primary antibody (Ab ...
-
bioRxiv - Cell Biology 2021Quote: ... for 15 min and blocked for 2 h at RT or overnight at 4°C using 2% BSA (Bovine Serum Albumin, Sigma). Samples were incubated with respective primary antibody (Ab ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-α-tubulin (B-5-1-2, Sigma, T5168) and anti-MPM2 (Millipore ...
-
bioRxiv - Immunology 2020Quote: ... pneumoniae (LPSK.p., 2-5 µg ml-1, Sigma Aldrich) or overnight bacterial cultures were added and incubated for one hour ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-α-tubulin (B-5-1-2; Sigma, T6074); anti-GFP (Covance ...
-
bioRxiv - Immunology 2021Quote: ... 1 mg 5-Ethynyl-2′-deoxyuridine (EdU, Sigma-Aldrich) diluted in PBS was intraperitoneally or intravenously injected at indicated time-points post immunization ...
-
bioRxiv - Microbiology 2022Quote: ... mouse anti-tubulin (B-5-1-2; Sigma-Aldrich), and mouse anti-GAPDH (MCA4739 ...
-
bioRxiv - Microbiology 2023Quote: ... natamycin (Sigma-Aldrich, Germany, 2 or 5 mg.L-1) or tebuconazole (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... and α-tubulin (clone B-5-1-2; Sigma) were detected using secondary anti-mouse (Rockland ...
-
bioRxiv - Microbiology 2023Quote: ... A (5:2:1) mixture of methanol (Sigma Aldrich) and chloroform (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse α-tubulin (clone B-5-1-2, Sigma); rabbit α-Histone H3 (ab1971 ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: Mice aged 6 months or naked mole-rats aged 2-4 years were given intraperitoneal (i.p.) injections with 150mg/kg 5-Fluorouracil (5-FU; Sigma) from a 50mg/ml stock in DMSO diluted with sterile 0.9% sodium chloride solution (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were cultured for 72 h and then cell death was measured using the tetrazolium dye (2,3)-bis-(2-methoxy-4-nitro-5-sulphenyl)-(2H)-terazolium-5-carboxanilide (XTT) assay (Sigma) according to manufacturer’s instruction ...
-
bioRxiv - Bioengineering 2021Quote: ... they were anaesthetized in 3-amino benzoic acid ethyl ester (Tricaine/ethyl 3-aminobenzoate; Sigma Aldrich; 168 μg·ml−1 in Tris pH 7) and embedded in 1% low melting point agarose (UltraPure Agarose ...
-
bioRxiv - Cell Biology 2020Quote: Cells were incubated at 4°C for 5 min with mouse serum-opsonized zymosan (Sigma, Z4250) or L ...
-
bioRxiv - Cell Biology 2019Quote: ... the coverslips were pre-coated overnight at 4°C with 5 µg/ml fibronectin (EMD Millipore) in 1× PBS and washed with 1× PBS immediately before added the cell mixtures ...
-
bioRxiv - Microbiology 2023Quote: ... 4 °C) and resuspended in 5 mL of Phosphate Buffered Saline (PBS, pH 7.2, Sigma-Aldrich). The resulting pellet was resuspended in 1/50 of the initial volume of the initial sample ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were incubated for 1 h at 4°C with 1 μg streptavidin (Sigma) and then resolved in SDS-polyacrylamide gel under reducing conditions ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were incubated for 1 h at 4°C with 1 µg streptavidin (Sigma) and then resolved in SDS-polyacrylamide gel under reducing conditions ...
-
bioRxiv - Biochemistry 2022Quote: ... and concentrated to 13.7 mg·ml-1 (A280=23.36) using a centrifugal filter (Amicon Ultra-0.5, MWCO 3 kDa, Merck Millipore) prior to crystallization ...
-
bioRxiv - Cell Biology 2024Quote: ... One-milligram of lysate was incubated overnight at 4°C with 20 µl of Anti-Flag M2 magnetic beads (Sigma-Aldrich). After extensive washing in RIPA buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-fluorouracil (5-FU) : 3 µM (F6627; Sigma), cisplatin (CDDP ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell suspensions (some of which were pooled from tumors harvested from 2-3 mice) were stimulated for 5 h with PMA (5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were fed by dichloro-dihydro-fluorescein diacetate (DCFH-DA)(D6883, Sigma-Aldrich) for 60 min in fresh DMEM media ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were passaged at a 1:3 to 1:6 ratio every 7 days using cell dissociation solution-non enzymatic (Sigma) and plated in fresh BME matrix droplets.
-
bioRxiv - Neuroscience 2024Quote: ... 2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (cAMP; 50 μM, Millipore Sigma, D0627), and cis-4 ...
-
bioRxiv - Immunology 2024Quote: ... washed with 1× PBS and stained with 2′,7′-dichlorofluorescein diacetate (DCFDA, Sigma-Aldrich, USA) for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Jurkat T cells and serum were permeabilized with ice-cold methanol containing with 1.5 µg/ml 4-Chloro-Phenylalanine (Sigma-Aldrich) as internal standard (IS) ...
-
bioRxiv - Neuroscience 2022Quote: ... the cells were treated with 1 x 10-5 M 5-fluoro-2-deoxy-uridine and with 1 x 10-5 M uridine (Sigma) for 3 days ...
-
bioRxiv - Neuroscience 2021Quote: ... Rabbit α-c-Fos (1:750, Millipore PC38, Ab-5 RRID:AB_2314421). After primary antibody incubation and washing 3 times with PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Cre-mediated recombination was induced in mice 3-7 months of age by intraperitoneal injection of 2 mg/day tamoxifen (Sigma-Aldrich) diluted with 300 μl corn oil (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... All samples with SDS sample buffer were heated at 95°C for 5 minutes and reduced with 5% 2-mercaptoethanol (Sigma) as needed.
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were denatured for 5 min at 95 °C in Bolt LDS Sample buffer with 5 % v/v 2-mercaptoethanol (Sigma). 10-30 μg of proteins were loaded in Bolt 4-12 % Bis-Tris gels (Thermo ...
-
bioRxiv - Cell Biology 2020Quote: ... the membrane was washed once with TBST and incubated with primary antibodies at 4°C for 12 hrs (Phospho-ERK1/2 1:500 (Sigma Aldrich, #E7028); ERK1/2 1:1000 (Cell Signaling ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 mM 7-benzyloxy-4-trifluoromethylcoumarin (BFC, Sigma-Aldrich, MD) and cell homogenate (20 – 100 mg protein ...
-
bioRxiv - Biochemistry 2019Quote: ... L-Leucine-7-amido-4-methylcoumarin hydrochloride (Sigma-Aldrich, L2145) (H-Leu-NH-Mec) ...
-
bioRxiv - Microbiology 2024Quote: ... and L-leucine-7-amido-4-methylcoumarin (LAPase) (Sigma, Aldrich) were prepared according to Hoppe (1983 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2% Ara-C (Sigma) in 0.9% saline or saline alone was infused directly in the lateral ventricle (ipsilateral side ...
-
bioRxiv - Physiology 2021Quote: ... and then stained for 2 hours in 1 mL of M9 containing 150 μM 2’,7’-dichlorofluorescein diacetate (DCFDA, Sigma) while rotating in the dark ...
-
bioRxiv - Plant Biology 2022Quote: ... Roots were sliced and placed in a petri dish (Falcon 351008) holding one 70 μm strainer (Falcon 352350) with 7 ml buffer B (cellulase 15 g l−1, (Sigma #C1794) and pectolyase 1 g l−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were centrifuged for 5 min at 700g and treated for 10 min with DAPI (4’,6-diamidino-2-phenylindole) (1:4000, Sigma, 62248) to label dead cells ...
-
bioRxiv - Microbiology 2023Quote: ... Washed beads were adjusted to pH 7.5 with 200 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) and bound proteins were reduced using 5 mM dithiothreitol (Sigma-Aldrich) at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... staining solution (0.3 mg/ml of 5-bromo4-chloro-3indolyl β-D-galactoside, X-Gal Fermentas R0401, 40 mM citric acid, Sigma C-0759, 40 mM sodium phosphate, Sigma S5011 ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500B microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Microbiology 2019Quote: ... 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES; Sigma Aldrich), Sodium chloride (NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:200; Sigma Aldrich) was used ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500 microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Neuroscience 2022Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma) for nuclei counterstaining ...