Labshake search
Citations for Millipore Sigma :
5901 - 5950 of 10000+ citations for Recombinant Human ROR1 Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... The protein was applied to column packed with ATP-agarose (Sigma Aldrich) and the column was washed with buffer A (25 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were transferred to low fluorescence PVDF membrane (Millpore Sigma cat. # IPFL00010). REVERT total protein stain was used to detect and quantify transferred proteins ...
-
bioRxiv - Biochemistry 2021Quote: ... and equal amount of protein was subjected to benzonase nuclease (Millipore Sigma) treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were transferred to a PVDF membrane (Merck Millipore cat. No. IPFL00010) after which the membrane was blocked using Odyssey Blocking buffer (PBS ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... The separated proteins were transferred onto PVDF membrane (Millipore, Billerica, Massachusetts, USA) using phosphate-based transfer buffer (10 mM sodium phosphate monobasic ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... anti-microtubule-associated protein 2 (MAP2) Alexa 555 (1:500, MAB3418A5; Millipore), antimicrotubule-associated protein 2 (MAP2 ...
-
bioRxiv - Physiology 2021Quote: ... The protein peak was collected and 20μM of iodoacetamide (Sigma-Aldrich; I1149) was added to the solution ...
-
bioRxiv - Bioengineering 2021Quote: ... the protein bands were developed using an enhanced chemiluminescent detection kit (Millipore). The optical bands were visualized in a Fuji Las-3000 dark box (FujiFilm) ...
-
An optimized ChIP-Seq framework for profiling of histone modifications in Chromochloris zofingiensisbioRxiv - Genomics 2021Quote: ... We used 50 mg of Protein-A-Sepharose beads (Sigma, P3391-1G), resuspended beads in 1 ml ChIP-buffer (1.1% Triton X-100 ...
-
bioRxiv - Cell Biology 2019Quote: Purified proteins in indicated concentrations were incubated with fluorescently labelled ssODN (Sigma) (0.25μM-6-FAM-39mer-5’GCGCGCCCATTGATACTAAATTCAAGGATGACTTATTTC3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were then alkylated by the addition of 10 mM iodoacetamide (Sigma) for 15 min ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Proteins and antigens were wet-transferred in TGS 1X (Sigma T7777-1L) with methanol 20% to a nitrocellulose membrane (Amersham 10600004 ...
-
bioRxiv - Genetics 2021Quote: ... The eluted protein was concentrated with Amicon Ultra 50 Kda filters (Millipore) and loaded into a Superdex 200 10/300 size-exclusion column (Cytiva ...
-
bioRxiv - Immunology 2020Quote: ... Proteins were loaded onto Polyvinylidene difluoride (PVDF) membranes (Millipore, Temecula, CA, USA) in buffer containing 10% Tris-glycine and 15% methanol ...
-
bioRxiv - Microbiology 2020Quote: ... and probed with protein-specific antisera against 3xFLAG (Sigma-Aldrich, cat# F1804), 6xHis (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: RIP was performed by Magna RIP RNA binding protein immunoprecipitation kit (Millipore). A549 cells were lysed into RIP lysis buffer ...
-
bioRxiv - Immunology 2021Quote: ... these mice were challenged by injection of 50 µg ova protein (Sigma) into the hind paw ...
-
bioRxiv - Immunology 2021Quote: ... Non-specific protein was blocked with 2 % normal donkey serum (Sigma Aldrich) in PBS containing 0.05 % Tween-20 and 1 % BSA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The proteins were transferred to an Immobilon-P Transfer Membrane (EMD Millipore) by wet-blotting ON at 4°C at 25 V ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein product was concentrated with a centrifugal filter unit (MD Millipore) and concentration determined by Bradford staining against a BSA standard ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein solution was concentrated on 10 kDa MWCO filter (Amicon-Millipore) and further purified on size exclusion column Superdex 200 in lysis buffer where β-mercaptoethanol was replaced with 1 mM TCEP ...
-
bioRxiv - Immunology 2021Quote: ... The purified proteins were validated by EZBlue™ Gel Staining (G1041, Sigma) or immunoblotting.
-
bioRxiv - Immunology 2020Quote: ... The purified protein content was measured by Bradford assay (B6916, Sigma-Aldrich) and analyzed under reducing conditions with 12% SDS-PAGE ...
-
bioRxiv - Molecular Biology 2020Quote: The eluted protein was concentrated using Amicon Ultra-centrifugal filters-50K (Millipore). The concentrated sample was further purified by gel filtration on HiLoad 16/600 Superdex200 column (GE Healthcare ...
-
bioRxiv - Microbiology 2019Quote: ... Protein quantification was performed using the Direct Detect® system (Merck-Millipore). Each sample was set to 40 µg of total protein in 100 µl in 100 mM TEAB ...
-
bioRxiv - Neuroscience 2021Quote: ... protein extracts were applied to 30kDa MWCO centrifugal filter units (Microcon, Millipore), mixed with UA buffer (8M urea ...
-
bioRxiv - Neuroscience 2020Quote: ... the target proteins were detected by an enhanced chemoluminescence reagent (ECL, Millipore) with an image acquisition system (Biostep ...
-
bioRxiv - Microbiology 2020Quote: ... The protein pellet was solublized with NuPAGE Sample Buffer + 5% BME (Sigma) and run on a 10-12% Bis-Tris MOPS gel (Thermo) ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentration was quantified using a Direct Detect Spectrometer (Millipore, DDHW00010- WW), and 40 μg of proteins/sample was loaded onto S-trap columns (Protifi ...
-
bioRxiv - Microbiology 2022Quote: The MLB1 CPNTD protein was produced in Rosetta 2 (DE3) cells (Novagen) cultured in 2×YT media with overnight expression at 18 °C induced with 0.4 mM IPTG ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-Prosurfactant Protein C (pro-SP-C) antibody (1:4000) (Millipore, #AB3786). Antibodies were incubated in 2% powder milk in TBS pH 7.4 ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were separated using SDS-PAGE and transferred to PVDF membranes (Millipore) for Western blot analysis ...
-
bioRxiv - Plant Biology 2022Quote: ... incubated 40 min with 50 µL of magnetic protein G Dynabeads (Millipore) fused to a GFP monoclonal antibody (1/500 in PBS 0.002 % tween) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and proteins were transferred onto a PVDF membrane (Millipore, Cat. No. ISEQ00010). The membrane was blocked with 5% non-fat milk in tris buffered saline with 0.1% Tween 20 (TBS-T ...
-
bioRxiv - Plant Biology 2022Quote: ... Eluted protein was concentrated with a 30 kDa centrifugal filter unit (Millipore) and purified by size-exclusion chromatography (HiLoad 16/600 Superdex 200 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The eluted proteins were concentrated using an Amicon Ultra centrifugal device (Millipore) with 100 kDa MW cut-off ...
-
bioRxiv - Biochemistry 2022Quote: ... Solubilized protein was loaded onto 1.5 mL of M2 affinity matrix (Sigma) equilibrated with wash buffer (20 mM MES pH 6.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... The concentrated protein was immobilized on cyanogen bromide activated Sepharose 4G (Sigma) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... the reduced proteins were alkylated with 150 mM Iodoacetamide (Millipore, Bedford, USA) in darkness at room temperature for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: All proteins were reduced by incubating with 10 mM of dithiothreitol (Sigma) at 56 °C and alkylated by 27.5 mM of iodoacetamide (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA-protein complexes were crosslinked using 1% final concentration of formaldehyde (Sigma) for 10min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... The proteins were then transferred to 0.2 μm nitrocellulose membranes (Millipore, 10600001) using a wet tank system at 115 V for 1 h at 4°C in Tris-Glycine buffer (25 mM Tris ...
-
bioRxiv - Immunology 2022Quote: ... Commercially available flavivirus E protein-specific mAb 4G2 (EMD Millipore, Darmstadt, Germany), rabbit anti-ZIKV prM and C antibodies (GeneTex ...
-
bioRxiv - Genetics 2022Quote: ... and 0.1% sodium dodecyl sulfate) containing a protein inhibitor cocktail (Sigma-Aldrich). The homogenate was centrifuged for 10 minutes at 10,000g and the supernatant was collected ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein concentrations were determined using a Direct Detect Infrared Spectrometer (Millipore Sigma).
-
bioRxiv - Molecular Biology 2022Quote: ... we used the protein synthesis inhibitor cycloheximide (CHX, Sigma-Aldrich, Deisenhofen, Germany). CHX inhibits eEF2-mediated translocation in eukaryotic ribosomes (Schneider-Poetsch et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-microtubule-associated protein 2a+b (MAP2, Sigma #M1406; 1:2000), rabbit anti-tyrosine hydroxylase (TH ...
-
bioRxiv - Plant Biology 2022Quote: ... and fusion proteins purified according to manufacturer’s instructions (GE Healthcare or Novagen). Protein-protein binding buffer contained ...
-
bioRxiv - Neuroscience 2022Quote: ... RRID:AB_839504) and myelin basic protein (MBP; rat anti-MBP; #MAB386, Millipore; RRID:AB_94975).
-
bioRxiv - Neuroscience 2022Quote: Total protein concentrations were measured using the Pierce BCA method (Sigma, USA). Equivalent amounts of protein (40 mg per lane ...