Labshake search
Citations for Millipore Sigma :
501 - 550 of 2489 citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Mrhl shRNAs (custom synthesised) and non-target control (SHC332) were procured from Sigma-Aldrich. qPCR was performed using BioRad’s CFX96 machine ...
-
bioRxiv - Cancer Biology 2020Quote: ... VCaP cells were cultured for five days following transfection PAT4 shRNA lentivirus (TRCN0000043984; Sigma). Cells were incubated in the isolation media for a period of 24 hours and EVs were purified from the conditioned media via size-exclusion chromatography (SEC).
-
bioRxiv - Cancer Biology 2021Quote: Short hairpin RNAs (shRNA) for target genes and scramble (shCtrl) were purchased from Sigma. pBabe-puro plasmids containing human C/EBPB LAP2 and LIP isoforms were from Addgene (Cat.# 15712 and 15713).
-
bioRxiv - Cancer Biology 2021Quote: ... and A549TP53-/- A3A) were made using the Mission shRNA lentiviral vector NM_020187.1-133s1c1 (Sigma). Lentiviral particles were produced in HEK293T cells using a pLKO.1-shRNA plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50,000 human ECs (RBPJ knock-out or shRNA for CXCL2 (pLKO.1; Sigma Aldrich) and respective controls ...
-
bioRxiv - Physiology 2022Quote: ... pLKO-PCMT1 construct (TRCN0000036403) and Non-Target shRNA Control (SHC016) were from Sigma-Aldrich. Lentiviral pLKO constructs were transfected with packaging and envelope plasmids to HEK293T cells ...
-
bioRxiv - Immunology 2020Quote: ... were obtained from the whole RNAi human library for shRNA mediating silencing (Sigma, Aldrich) maintained at IISER ...
-
bioRxiv - Cell Biology 2022Quote: ... or PTK7-targeting shRNAs from the Sigma MISSION library (Millipore Sigma, Cat# SHCLNG-NM_002821): sh31 ...
-
bioRxiv - Immunology 2020Quote: ... were obtained from the whole RNAi human library for shRNA mediating silencing (Sigma, Aldrich) maintained at IISER ...
-
bioRxiv - Microbiology 2019Quote: ... was used to express short hairpin RNAs (shRNAs) targeted against REAF (Mission TRCN0000141116, Sigma). Additionally ...
-
bioRxiv - Microbiology 2020Quote: Three lentiviral Mission short hairpin RNA (shRNA) clones targeting UBE4B were obtained from Millipore-Sigma ...
-
bioRxiv - Immunology 2022Quote: ... three short hairpin RNAs (shRNAs) against DRAM1 (NM_027878) from the Mission library (Sigma-Aldrich) were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... The shRNAs expressed by the pKLO.1-puro vector were purchased from Sigma-Aldrich. The sequences for human shDiPRO1 were as follows:
-
bioRxiv - Molecular Biology 2023Quote: ... The 4EBP1 shRNA lentivirus carrying puromycin resistance was purchased as lentiviral particles (Sigma-Aldrich). The 4EBP2 shRNA was cloned into the pLKO.1_BlastR lentiviral backbone (52) ...
-
bioRxiv - Cancer Biology 2023Quote: Predesigned shRNA in the puromycin-selectable pLKO.1 vector were obtained from Sigma Aldrich, targeting the following sequences – CTNNB1 ...
-
bioRxiv - Cell Biology 2023Quote: ... lentiviral particles harboring shRNA machinery within pSicoR-puromycin vectors were obtained from Sigma-Aldrich (scramble control ...
-
bioRxiv - Cancer Biology 2023Quote: The MISSION lentiviral-based shRNA vector collections from Sigma Aldrich (St. Louis, MO, USA) were used for long-term silencing of BRD4 ...
-
bioRxiv - Neuroscience 2023Quote: ... The shRNA construct for ARID1A (target sequence: TGGACCTCTATCGCCTCTATG, NM_006015) was obtained from Sigma (TRCN0000358749). This pLKO.1-based construct was packaged into lentiviruses ...
-
bioRxiv - Biochemistry 2024Quote: ... Induction of shRNA expression was achieved by treating cells with 1µg/ml doxycycline (Sigma) for 72 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... and two distinct shRNAs targeting human NINJ1 RNA were acquired from Sigma (TRCN0000063769, TRCN0000289088). For the overexpression of both NINJ1 and xCT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Inducible shRNA expression was activated using 1 µg/mL doxycycline (hyclate D9891, Sigma Aldrich) in the culture medium ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA 3F10 (Sigma). Secondary antibodies were ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (Sigma #11867423001) 1:200 ...
-
bioRxiv - Biochemistry 2020Quote: ... Rat anti-HA (#ROAHAHA, Sigma), mouse monoclonal anti-Rab7A (#R8779 ...
-
bioRxiv - Neuroscience 2019Quote: ... Urocortin (rat) protein (Millipore Sigma, ~2μl of 40μM in 1x PBS + 0.1% acetic acid ...
-
bioRxiv - Cancer Biology 2020Quote: ... Rat serum (R9759, Sigma-Aldrich) was added and samples incubated at 37°C for 2 hours to cleave polyglutamate tails on folate species ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti Argonaute 2 (Sigma), mouse anti-MAG (clone 513 ...
-
bioRxiv - Cell Biology 2021Quote: ... fluorescein-conjugated α-rat (Millipore), Cy3-labeled α-goat (GE Healthcare) ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-somatostatin (Millipore, MAB354) at 1:200 overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... Rat anti-HA 3F10 (Sigma) was applied at a 1:500 dilution ...
-
bioRxiv - Neuroscience 2022Quote: Rat α-CGRP (Sigma-Aldrich) was diluted in 1X phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2022Quote: ... 1% rat serum (Sigma-Aldrich), 1% mouse serum (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: ... 50μg/mL Rat IgG (Sigma) was included as block with all staining ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-Somatostatin (SST, Millipore, Rat), anti-Calretinin (CR ...
-
bioRxiv - Immunology 2020Quote: Rat IgG (Sigma, Cat#I4131) or 1H1 anti-TF antibody (Genentech ...
-
bioRxiv - Immunology 2020Quote: ... 1% rat serum (Sigma-Aldrich), 1% mouse serum (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-rat (Sigma-Aldrich) antibodies were used.
-
bioRxiv - Immunology 2023Quote: ... & 10% rat & mouse serum (Sigma) and stained for cell surface markers (See Supplementary Table 1 for list of antibodies used) ...
-
bioRxiv - Plant Biology 2023Quote: ... anti-rat antibody (Sigma-Aldrich) were used as secondary antibodies ...
-
bioRxiv - Neuroscience 2024Quote: ... and rat anti-somatostatin (Millipore). The appropriate 488 ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-MBP rat (Millipore MAB386), anti-CC1 mouse (Calbiochem OP80) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HsNHE9 targeting short hairpin RNA (shRNA) (5’-CCGGCCCTCCATTAAGGAGAGTTTTT CAAGAGAAAACTCTCCTTAATGGAGGTTTTTC-3’) and scramble control (Sigma-Aldrich) (5’-CAACAAGATGAAGAGCACCAA-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: SOX4 short hairpin (sh)RNAs for lentiviral transduction were obtained from Sigma (MISSION shRNA library). We tested six shRNAs and identified the most effective two shRNAs ...
-
bioRxiv - Cancer Biology 2020Quote: ... CALCRL MISSION shRNA (shCALCRL#1, Sigma-Aldrich, Cat# TRCN0000356798; shCALCRL#2, Sigma-Aldrich, Cat# TRCN0000356736), E2F1 MISSION shRNA (Sigma-Aldrich ...
-
Hydrogen sulfide blocks HIV rebound by maintaining mitochondrial bioenergetics and redox homeostasisbioRxiv - Microbiology 2021Quote: ... we used validated pooled gene specific shRNAs from the RNAi Consortium (TRC) library (Sigma Aldrich, USA ...
-
bioRxiv - Cancer Biology 2021Quote: ... TRCN0000107538-shLBH#3 and TRCN0000107533-shLBH#4) or a non-targeting control shRNA (Sigma, SHC002V) at MOI=5 and in the presence of 8 μg/ml polybrene ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNAs targeting ERF to develop PNT2 shERFA1 and PNT2 shERFB1 were obtained from Sigma-Aldrich: TRCN000001391 ...
-
bioRxiv - Immunology 2019Quote: ... IFITM knockdown lines were generated and maintained similarly using lentiviral shRNA constructs purchased from Sigma as described previously (38).
-
bioRxiv - Microbiology 2021Quote: ... EPCRkd PLB985 cells were generated by lentiviral transduction with EPCR specific shRNAs from Sigma (TRCN0000300553). Control cells were transduced an empty vector (pLKO) ...
-
bioRxiv - Cell Biology 2022Quote: Parental Cells or cells expressing the indicated shRNA were labeled with red (PKH 26, Sigma) or green (PKH67 ...