Labshake search
Citations for Millipore Sigma :
651 - 700 of 2589 citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... All lentiviral vectors (pLKO.1) expressing shRNAs used for knockdown of host proteins were purchased from Sigma.
-
bioRxiv - Genomics 2019Quote: The MISSION pLKO.1-puro human TDP-43 (TRCN0000016038) and control shRNAs (Sigma Aldrich SHC007 and SHC016) were used to produce lentivirus ...
-
bioRxiv - Cell Biology 2019Quote: MISSION TRC shRNA lentiviral library containing 80’000 lentiviral clones targeting 15’000 genes was purchased from Sigma-Aldrich. Cells (3,000 per well ...
-
bioRxiv - Immunology 2021Quote: Lentivirus based knockdown of human ATG16L1 (5’-ACTGTAGCTTTGCCGTGAATG-3’) was performed using MISSION shRNA constructs (Sigma-Aldrich) and psPAX2 packaging system ...
-
bioRxiv - Molecular Biology 2021Quote: All lentivirus-based shRNA clones used for making the viral transduction particles were purchased from Sigma-Aldrich. pLKO.1-Puro vector targeting human PPARA or non-target vector as a control was used ...
-
bioRxiv - Microbiology 2021Quote: ... ICAM-1kd PLB985 cells were generated by lentiviral transduction with ICAM-1 specific shRNAs from Sigma (TRCN0000372478). EPCRkd PLB985 cells were generated by lentiviral transduction with EPCR specific shRNAs from Sigma (TRCN0000300553) ...
-
bioRxiv - Immunology 2020Quote: ... MISSION shRNA Lentiviral Transduction Particles against human CLPP (TRCN0000291174) or eGFP (RHS4459) were purchased from Sigma-Aldrich and Horizon Discovery respectively ...
-
bioRxiv - Cancer Biology 2022Quote: Expression of either CAPN1 or CAPN2 was knocked down in U251N using shRNA purchased from Sigma-Aldrich (CAPN1 ...
-
bioRxiv - Cell Biology 2022Quote: shRNAs against APPL1 and EEA1 were selected from de Broad Institute GPP database and purchased from Sigma (MISSION TRC shRNAs purified plasmid DNA) ...
-
bioRxiv - Cancer Biology 2022Quote: pLKO.1-puro lentiviral vectors expressing shRNAs targeting HSP8A (shHSPA8_1: NM_006597.3-2040s21c1) and HSP90AA1 (NM_005348.x-1505s1c1) were purchased from Sigma-Aldrich. These vectors contain a puromycin antibiotic resistance gene for selection of transduced mammalian cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... shRNAs that stably integrated into mouse cells were chosen through selection with 10 μg/ml puromycin (Sigma). For the generation of Nat10-overexpressing cells ...
-
bioRxiv - Cell Biology 2024Quote: Stable MMP9 knockdown cell lines were generated using two independent shRNA sequences (CCACAACATCACCTATTGGAT and CAGTTTCCATTCATCTTCCAA; Sigma Aldrich). The transduced cells were selected using puromycin (Catalogue number CMS8861 ...
-
bioRxiv - Cancer Biology 2023Quote: ... we transduced MCF7 and HS5 cells with shRNA against CCDC88A (clone TRCN0000129915, Millipore Sigma, Burlington, MA, USA), preparing lentiviruses as described previously (87) ...
-
bioRxiv - Cancer Biology 2023Quote: An shRNA library targeting 284 pancreatic cancer related genes was generated using the pLKO vector backbone (Sigma). Each gene was targeted with 3-4 shRNA producing a library size of 1013 shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... As a control we used a shRNA against Luciferase (cat# SHC007, Sigma-Aldrich, Saint Louis, MO, USA). The following sequences were used as a shRNA target shRNA-Luciferase ...
-
bioRxiv - Cancer Biology 2023Quote: ... The LDHA shRNA vector (TRCN0000164922) was validated for 96% knockdown in HEK293T cells (Sigma, St. Louis, MO). Both vectors were packaged into lentiviral particles prior to transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lentiviral shRNA constructs in the pLKO.1-puro vector were purchased as glycerol stocks from Millipore Sigma. For shADAR1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or control cells expressing non-mammalian targeting control shRNA (pLKO.1-Puro_shCtrl; MISSION® SHC002, Sigma-Aldrich) were generated using HEK293T cells ...
-
bioRxiv - Pathology 2020Quote: ... Male Sprague-Dawley rats (200–220 g, 30 rats/group) were anesthetized using chloral hydrate (Sigma-Aldrich, USA). The control (sham ...
-
bioRxiv - Cancer Biology 2021Quote: ... or rat IgG (cat. #I4131, Sigma-Aldrich), was diluted in 0.1 ml sterile PBS then given to mice by IP injection repeated on days -5 ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (Sigma; 1:500 dilution), mouse m2 anti-FLAG (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (Sigma; 1:1000 dilution), and mouse m2 anti-FLAG (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... with 1%normal mouse/rat serum (Sigma), and FC block (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... rat anti-GFAP (1:500, Millipore 345860) diluted in PBS containing 5% normal serum and 0.2% Triton-X ...
-
bioRxiv - Neuroscience 2021Quote: ... rat anti-SST (1:200, Millipore #MAB354), rabbit anti-dsRed (1:500 ...
-
bioRxiv - Neuroscience 2019Quote: ... rat anti-somatostatin (1:100, MAB354, Millipore), guinea pig anti-parvalbumin (1:200 ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-HA (3F10) rat monoclonal (Sigma, 11867423001), and anti-cytochrome C 6H2.B4 (BD Pharmingen ...
-
bioRxiv - Neuroscience 2020Quote: ... Rat anti-CTIP2 (1:200, Sigma; MABE1045). Mouse anti-SATB2 (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-somatostatin (1:300, EMD Millipore), rabbit anti-active caspase 3 (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... and rat N27 dopaminergic neural cells (Millipore) were maintained in Roswell Park Memorial Institute (RPMI ...
-
bioRxiv - Cancer Biology 2020Quote: ... rat tail collagen type I (Sigma-Aldrich) was dissolved in 0.25% acetic acid and diluted 1:1 with 2 x MEM (Gibco ...
-
bioRxiv - Immunology 2020Quote: ... CD13 (SL13, Millipore, MABC950, rat monoclonal Ab)
-
bioRxiv - Physiology 2021Quote: ... Rat anti-SST 1:200 (Millipore, MAB354), Rat anti-Substance P (TAC1 ...
-
bioRxiv - Microbiology 2020Quote: ... Rat anti-HA (Sigma-Aldrich, cat. # 11867423001) (1:500) ...
-
bioRxiv - Physiology 2022Quote: H9C2 rat cardiomyoblasts (Sigma-Aldrich; Buchs, Switzerland) were expanded in Dulbecco’s Modified Eagle’s Medium-high glucose (DMEM ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-somatostatin rat (Millipore MAB354, 1:400); anti-HuCD IgG2B (Thermo 16A11 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-DAT (Millipore MAB369, RRID: AB_2190413), 1:200 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rat anti-Integrin α6 (1:100; Millipore; Burlington ...
-
bioRxiv - Developmental Biology 2022Quote: ... rat anti-GFP (Millipore, #MAB3580, 1:200), chicken anti-GFP (1:1000) ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-DAT (1:1000, Millipore, MAB369), rabbit anti-ALDH1A1 (1:500 ...
-
bioRxiv - Plant Biology 2021Quote: ... and anti-rat alkaline phosphatase (Sigma-Aldrich) antibodies were used as secondary.
-
bioRxiv - Microbiology 2020Quote: ... or rat monoclonal 3F10 (Sigma-Aldrich 11867423001). The Ty1 epitope was detected with mouse mAb BB2 (58) ...
-
bioRxiv - Neuroscience 2021Quote: Rats were anesthetized using urethane (Sigma-Aldrich, Tokyo ...
-
bioRxiv - Biochemistry 2022Quote: Rat monoclonal antibody to HA-HRP (Sigma, cat ...
-
bioRxiv - Neuroscience 2019Quote: ... rat anti-HA (1:100, Sigma #11867423001), chicken anti-V5 (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-L1 (rat, MAB5272, Millipore, 1:200), anti-MAP2 (mouse ...
-
bioRxiv - Neuroscience 2019Quote: ... rat anti-Cx43 (1:1,000; Sigma C6219), rabbit anti-Col4 (1:200 ...
-
bioRxiv - Cell Biology 2019Quote: ... α-tubulin (rat, EMD Millipore CBL270, 1:500), pericentrin (rabbit ...
-
bioRxiv - Microbiology 2020Quote: ... rat anti-HA (1:1,000, Sigma Aldrich), rat anti-PfBiP (1:1,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Rat anti-MBP (1:250, Millipore MAB386). Sections were then rinsed four times in D-PBS and then stained with appropriate fluorophore-conjugated (Alexa 488 ...