Labshake search
Citations for Millipore Sigma :
5401 - 5450 of 10000+ citations for Suppressor of CDC2 With RNA Binding Motif 2 RBMS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: Total RNA was isolated using TRI REAGENT (Sigma) according to manufacturer’s instructions and quantified using a spectrophotometer (BioPhotometer ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA was prepared using Tri reagent (Sigma). Total RNA was also directly prepared from two mm SC sections at 5 ...
-
bioRxiv - Immunology 2020Quote: Total RNA was isolated with TRI-Reagent (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA was extracted using Tri-Reagent (Sigma) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: RNA samples were collected by standard Trizol (Sigma) method and cDNA was prepared by Bio-Rad iScript cDNA synthesis kit ...
-
bioRxiv - Molecular Biology 2019Quote: ... The single-stranded RNA mimics were synthesised (Sigma) with 5’-phosphorylation and 2’-fluoro modification for stability ...
-
bioRxiv - Molecular Biology 2021Quote: ... total RNA was extracted with Tri-reagent (SIGMA) from larval brains and reverse transcribed with Superscript II as described 44 ...
-
bioRxiv - Neuroscience 2020Quote: Sc1 RNA (GCUGCGGUGUGGAAGGAGUGGUCGGGUUGCGCAGCG) was purchased from Sigma-Aldrich as lyophilized samples ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was incubated with nuclease P1 (Sigma, 2U) in buffer containing 25mM NaCl and 2.5mM ZnCl2 for 2h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was extracted from cells using TRIreagent (Sigma) following manufacturer’s instructions and RNA integrity assessed using a Bioanalyzer 6000 pico chip (Agilent) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was extracted using TriReagent (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted with phenol (Sigma-Aldrich)/chloroform (Avantor ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: RNA extraction was done using Tri-reagent (SIGMA) and reverse transcription was done with Superscript II (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was DNase-treated (Sigma DNAse I) and reverse transcribed in a C1000 Touch Thermal Cycler (Bio-Rad Laboratories ...
-
bioRxiv - Genetics 2020Quote: RNA was extracted with Trizol (Sigma Aldrich, Italy) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA was extracted using Trizol reagent (Sigma T9424) and RNA was kept at −80°C until further processing.
-
bioRxiv - Cancer Biology 2019Quote: ... Total RNA was extracted using TRI-reagent (Sigma), isopropanol (Sigma) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNA was extracted by TRI Reagent (Sigma) or Direct-zol RNA Miniprep Kit (Genesee Scientific) ...
-
bioRxiv - Bioengineering 2020Quote: RNA was extracted using TRIzol (TRI reagent, Sigma) according to manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted using TRIzol reagent (Sigma), according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RNA was collected using Trizol reagent (#T9424, Sigma) and 1 ug (100 ng/ul ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was extracted using TRI reagent (Sigma-Aldrich), according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted using TRI Reagent (SIGMA) from the frozen B ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 µg total RNA was DNase1-treated (Sigma) and used for cDNA synthesis (iScript™ from BIO RAD ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA was extracted using TRIreagent (Sigma-Alderich). One microgram of total lung RNA was used to perform a RT reaction in a total volume of 20 μl using Mx1 specific primer ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA was extracted using Tri-reagent (Sigma) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated using Tri-reagent (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... RNA was extracted using TRI reagent (Sigma Aldrich). After DNase digest ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RNA polymerase II were purchased from Millipore (#07-030 ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA probes were with Cy3-labeled oligonucleotides (Sigma), which are listed in Supplementary Table 2 ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated using Trizol (Sigma-Aldrich) and the RNA yield was quantified using Nanodrop 2000 spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA was isolated using TRIzol (Sigma Aldrich). RNA was further purified with a Qiagen RNeasy Plus mini kit (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... 100 ng phage MS2 phage RNA (Sigma-Aldrich), and 2 μL diluted viral lysate in a final volume of 25 μL ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was treated with DNase I (Sigma) at 37°C for 1 hour and reverse transcription was performed with RevertAid Reverse Transcriptase (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Epithelial sheets were incubated in RNA-later (Sigma) for 1 min immediately after isolation ...
-
bioRxiv - Developmental Biology 2021Quote: ... homogenised and RNA isolated using TRI Reagent (Sigma) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was extracted using TRI Reagent (Sigma-Aldrich), according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was extracted using TRI Reagent® (Sigma), genomic DNA was removed using the DNase RQ1 (PROMEGA) ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was extracted using Trizol reagent (Sigma) and treated with DNase I (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was isolated by the Trizol (Sigma Aldrich) method [55] and integrity of the RNA was analysed on a 1.2% formaldehyde agarose gel at 100 V for 90 min ...
-
bioRxiv - Microbiology 2021Quote: RNA was isolated using TRI Reagent (Sigma-Aldrich). RNA-seq was performed according to the manufacturer’s instructions (Illumina ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted using Tri-Reagent (Sigma) and polyA selected using the Dynabeads mRNA DIRECT purification kit (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2021Quote: RNA was isolated with Trizol (TRI REAGENT Sigma), DNAse-treated ...
-
bioRxiv - Physiology 2021Quote: ... RNA was isolated with Trizol (TRI REAGENT Sigma), DNAse-treated ...
-
bioRxiv - Molecular Biology 2022Quote: ... All the RNA oligos were purchased from Sigma of HPLC-purified grade ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted using TRI Reagent (Sigma 93289) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... GenElute Mammalian Total RNA Purification Kit (Sigma-Aldrich) was used to extract the total RNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... Isolated total RNA underwent gDNA elimination (#AMPD1, Sigma) and quality and quantity evaluation by spectrophotometer (#ND1000 ...
-
bioRxiv - Plant Biology 2019Quote: ... the RNA was extracted with Tri-reagent (Sigma) as per manufacturer instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was extracted using Tri-reagent (SIGMA) and reverse transcription was done with Superscript II (Invitrogen ...