Labshake search
Citations for Addgene :
351 - 400 of 957 citations for rno mir 143 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2024Quote: The coding sequence of V5::TurboID was PCR-amplified from V5-TurboID-NES_pcDNA3 (#107169; Addgene). The two fragments were then ligated into the XhoI-digested pUASz1.0 vector using In-Fusion ...
-
bioRxiv - Cell Biology 2024Quote: Human Pcdhga9 mutants were generated by cloning PCR-amplified fragments into pBob-GFP vector (Addgene). For GFP-tagged constructs ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplicons containing spacer sequences for two sgRNAs were generated from plasmid pCFD6 (Addgene 73915) using primers sgRNAampfwd ...
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... the FUS was amplified by PCR from the plasmid pHR-FUSN-mCh-Cry2WT (Addgene, #101223) with primer set #3 (Supplementary Table 1 ...
-
bioRxiv - Synthetic Biology 2023Quote: The CIDAR MoClo Parts Kit was a gift from Douglas Densmore (Addgene kit # 1000000059). CIDAR MoClo Extension ...
-
bioRxiv - Biochemistry 2022Quote: ... The PRESTO-Tango plasmid kit was a gift from Bryan Roth (Addgene kit # 1000000068).
-
bioRxiv - Molecular Biology 2023Quote: The CRISPaint gene tagging kit was a gift from Veit Hornung (Addgene kit # 1000000086). To generate a targeting construct for AGO2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... All GPCR plasmids originated from the Roth lab PRESTO-Tango kit (Addgene, Kit #1000000068) and were amplified in E ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The MoClo-YTK plasmid kit was a gift from John Dueber (Addgene kit # 1000000061). Enzymes used were from New England Biolabs unless stated otherwise ...
-
bioRxiv - Neuroscience 2020Quote: ... Feng Zhang (Addgene kit #1000000019). Once assembled into a destination vector ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR amplified and cloned between SalI and XbaI sites of pAV-U6+27 (Addgene, plasmid #25709) to yield pAV-U6+27-RhoBAST2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The SunTag (24 x GCN4 peptides) was PCR amplified from the plasmid pcDNA4TO-24xGCN4_v4_sfGFP (Addgene #61058) (Tanenbaum et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR-amplified from a previously assembled vector (ppk10779-T2A-QF2-SV40, 3xP3-dsRed, Addgene accession #130667)
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... ORC2 sgRNA (GAAGGAGCGAGCGCAGCTTT) was cloned into pCR-Blunt II- TOPO vector backbone (Addgene 41820, Cambridge, MA) using PCR and In-Fusion cloning (Clontech) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The Luc2TdTomato cassette was PCR amplified from the pcDNA3.1(+)/Luc2=TdT plasmid (Addgene, https://www.addgene.org/32904/)9 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bp::PhiC31 was made by PCR-amplifying the PhiC31 coding region from pPhiC31o54 (Addgene plasmid #13794) using an Xma1-tagged forward primer and a BsrG1-tagged reverse primer (see Supplementary Table S1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Homology arms were PCR amplified and cloned into pHD-dsRed-attP (Gratz et al.,2014) (Addgene). Guide RNAs and the donor vector were co-injected into nosP Cas9 attP embryos at the following concentrations ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse YAP cDNAs were isolated by PCR amplification using DNA templates obtained from Addgene (Watertown, MA) and cloned into a shuttle vector at Creative-Biogene (Shirley ...
-
bioRxiv - Neuroscience 2019Quote: The Sy-EKAR vector was created by PCR amplification of EKAR-GFP/RFP (38; Addgene #18680) to which a 4Gly linker domain (GGTGGCGGTGGA ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA encoding TNKS ARC1-5 (aa 174-985) was subcloned by PCR into pFLAG-CMV2 (Addgene.org). All vectors subcloned using PCR were sequenced on both strands for verification.
-
bioRxiv - Microbiology 2021Quote: ... the 3xmCherry cassette was PCR amplified from pGGC026 (pGGC026 was a gift from Jan Lohmann (Addgene plasmid # 48831 ...
-
bioRxiv - Microbiology 2020Quote: ... CASP8 ORF was amplified from pcDNA3-CASP8 by PCR (Addgene #11817, a gift from Guy Salvesen) (Stennicke & Salvesen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... by combining a PCR-amplified FNLS-APOBEC1 DNA from pLenti-TRE3G-FNLS-PGK-Puro (Addgene# 110847), PCR-amplified Cas9n-NG DNA from pX330-SpCas9-NG (Addgene# 117919) ...
-
bioRxiv - Molecular Biology 2022Quote: ... we carried out PCR to amplify the mScarlet sequence from the ITPKA-mScarlet plasmid (Addgene, USA) as well as the GRB2 sequence from GRB2-YFP (gift from J ...
-
bioRxiv - Biochemistry 2022Quote: ... and rat TRPM8 were amplified by PCR and subcloned into p3xFLAG-eYFP-CMV-7.1 vector (Addgene) at the NotI/BamHI sites or into 8xHis-MBP pFastBac1 modified with a CMV promoter (obtained from David Julius’ lab ...
-
bioRxiv - Cell Biology 2022Quote: ... The mNeonGreen2 sequence was PCR amplified from pLenti6.2_mNeonGreen2 (a gift from Vanessa LaPointe; Addgene plasmid # 113727) and was inserted in the AscI tagging site using Gibson assembly.
-
bioRxiv - Neuroscience 2020Quote: ... Two guides RNAs were selected and produced by PCR using the pX330 plasmid (Addgene, Watertown, MA) as a template ...
-
bioRxiv - Molecular Biology 2021Quote: ... The HaloTag sequence was obtained by PCR from pENTR4-HaloTag (gift from Eric Campeau, Addgene #29644). The donor plasmids for the ΔCTD ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Neuroscience 2021Quote: ... the U6-BbsI/BbsI cassette was PCR amplified from px458 (Addgene #48138, (Ran et al., 2013)) (forward ...
-
bioRxiv - Cell Biology 2022Quote: ... we Gibson assembled a PCR product containing CMV-StrepKDEL-IRES-SBP (amplified from Addgene plasmid #65295) to the SalI/MluI digested piggyback backbone (a generous gift from Jonathon Nixon-Abell ...
-
bioRxiv - Molecular Biology 2019Quote: ... the MCP-VP64-IRES-mCherry cassette was PCR amplified from the pJZC34 vector (Addgene, plasmid # 62331) and cloned into BsrGI/EcoRI digested lenti-sgRNA (MS2)-zeo backbone (Addgene ...
-
bioRxiv - Microbiology 2019Quote: ... PCR amplification of the cassette via Q5 polymerase for sticky-end cloning into vector pRS306 (Addgene) after restriction with the enzymes XhoI and XbaI led to plasmid pBBA5.1 ...
-
bioRxiv - Genomics 2019Quote: ... The minimal promoter and luciferase insert was prepared using biotinylated PCR primers (Amp_minPLuc2_Biotin_For and Amp_minPLuc2_Biotin_Rev) corresponding to pMPRAdonor2 (Addgene plasmid #49353) and Kapa HiFi HotStart ReadyMix (Kapa Biosystems) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... GEM effector expression cassette together with the LEU2 marker was PCR amplified from pHES83917 (Addgene # 87941) using primers OZL348 and OZL349 and integrated downstream of the YFL033C locus of SZL149 and SZL281 (SZL149+msh2Δ) ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product contained arms of homology to the acceptor plasmid (SM-KDM5B-MS2; Addgene #81084). The acceptor plasmid was cut with NheI (New England BioLabs ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product contained arms of homology to the acceptor plasmid (SM-KDM5B-MS2 Addgene #81084). The acceptor plasmid was cut with NotI (New England BioLabs ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272 ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by PCR amplification and insertion of 2A-PuroR (a gift from Brett Stringer; Addgene 98290) and TagBFP ...
-
bioRxiv - Genomics 2021Quote: We used PCR to add V5 epitope tags to the 3’ end of FoxA1 (Addgene #120438) and Hnf4a (Addgene #120450 ...
-
bioRxiv - Developmental Biology 2022Quote: LSSmKate2 and mBeRFP were individually amplified by PCR with specific primers from pLSSmKate2-N1 (Addgene #31867) and LK1-MpEF1+mBeRFP+Nos-T35S-T (gift from F ...
-
bioRxiv - Cell Biology 2020Quote: ... the fragment encoding EGFP-SV40 PolyA was PCR amplified from the pcDNA3-hL1 plasmid (Addgene #89411) with primers Fwd ...
-
bioRxiv - Cell Biology 2020Quote: ... the fragment encoding the hL1CAM ORF was PCR amplified from the pcDNA3-hL1 plasmid (Addgene #89411) with primers Fwd ...
-
bioRxiv - Molecular Biology 2021Quote: Notch1 and Jagged1 constructs were generated by polymerase chain reaction (PCR) using mouse Notch1 (Addgene 41728), human Notch1 (kind gift of Dr ...
-
bioRxiv - Genomics 2021Quote: ... pLuc2-PromLDLR was created by PCR expansion of the target luciferase from pGL4Luc-RLuc (Addgene 64034), custom gene synthesis of the LDLR promoter (NCBI Reference Sequence NG_009060.1 ...
-
bioRxiv - Genetics 2020Quote: ... The BamHI/ XhoI digested NCL PCR product was cloned into BamHI/ XhoI digested pGPD2 (Addgene; #43972). The NCL-ΔRGG plasmid was similarly created using primers NCL-For and NCLΔRGG-1XHA Rev (Table S1) ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... The amplified PCR products were ligated to the NotI and SalI linearized MSCV vector (RRID: Addgene_17442). The MSCV murine ADAR2E396A expression construct was generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) ...