Labshake search
Citations for Addgene :
1 - 50 of 961 citations for hsa mir 483 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... was used to clone a pool of four sgRNAs per gene (AGPS, SLC2A11, ZC3H7A, PDCD2L, NPM1, EPS15, hsa-mir-761, RPAP1, SYAP1, TRAF3IP1, and EGFP) into lentiCRISPR v2 (Addgene #52961). iOvCa147 cells were transduced with viral particles encoding a Cas9 and sgRNA expression cassettes ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLVX-anti-MIR211-5p (Addgene #153318), pLVX-anti-MIR328-3p (Addgene #153319) ...
-
bioRxiv - Cell Biology 2020Quote: ... primary miRNAs for miR-29a and miR-16 were amplified from genomic DNA by PCR and cloned into the pAdTrack shuttle (Addgene, Plasmid#16404). The miR-16 pAdTrack plasmid was then mutated by site-directed mutagenesis to induce 3 point mutations into the miR-16 seed sequence ...
-
bioRxiv - Bioengineering 2023Quote: ... miR-92a (Addgene #46672), let-7a (Addgene #51377 ...
-
bioRxiv - Biophysics 2024Quote: ... pHAGE-TO-dCas9-P2A-HSA (Addgene plasmid #121936), pHAGE-EFS-MCP-HALOnls (Addgene plasmid #121937) ...
-
bioRxiv - Neuroscience 2022Quote: ... Viral vectors were generated from Addgene plasmids #20297 and #50459 and titers determined via fluorometric quantification (Neuroscience Center Zurich) or by real-time quantitative PCR combined with SYBR green technology (Addgene). Respective titers were >9.1×1012 vector genomes/ml (Neuroscience Center Zurich ...
-
bioRxiv - Cancer Biology 2023Quote: pSIN-Clover-Puro and pSIN-Clover-miR-497-Puro were generated from the modified pSIN-Puro backbone utilizing pre-miR-497 cloned from the pMSCV-PIG-miR-497/miR-195 (Addgene #64236, a gift from Joshua Mendel17). Doxycycline-inducible shRNAs targeting Renilla and Vat1 were generated in LT3GEPIR61 (gift from Johannes Zuber ...
-
bioRxiv - Molecular Biology 2019Quote: ... the miR-141 indicator is from Addgene (#67632). To generate 3’UTR luciferase reporters for BCL6 ...
-
bioRxiv - Bioengineering 2023Quote: CHO cells were electroporated with 2 μg of plasmids containing the primary or a fragment of the primary microRNA sequences of three miRs that were in high abundance in standard or stressed cultures (miR-21 (Addgene #21114), miR-92a (Addgene #46672) ...
-
bioRxiv - Cell Biology 2024Quote: ... The HTR8 cells with mir-218 KO were generated by cloning gRNAs that target mir-218-1 and mir-218-2 into a CRISPR/Cas9 vector PX459 (Addgene #62988). The plasmid was verified by sequencing ...
-
bioRxiv - Bioengineering 2020Quote: An HSA expression plasmid was obtained from Addgene (ALB-bio-His, Plasmid #52176). E400R and K383D point mutations were introduced to the HSA sequence by the Q5 site-directed mutagenesis kit ...
-
bioRxiv - Molecular Biology 2024Quote: Two separate guide sequences targeting the miR-142 locus (SgID #10024 and #10033) from the pLX-miR pool (32) were cloned into vector pBA904 (Addgene Plasmid #122238). MutuI cells were transduced with lentiparticles derived from pCW-Cas9-Blast (Addgene Plasmid #83481 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cloned into a pINDUCER11 miR RUG (Addgene # 44363) backbone (49) ...
-
bioRxiv - Neuroscience 2020Quote: ... doxycycline-inducible pT-BclXL-miR-9/9*-124 (Addgene, 60857) and reverse tetracycline-controlled transactivator rtTA (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: mmu-mito-ncR-LDL805 (GAATTGATCAGGACATAGGGTTTGATAGTTAATATTATATGTCTTTCAAGTTCTTAG TGTTTTTGGGGTTTGGC) and hsa-mito-ncR-LDL805 (GAACGTGTGGGCTATTTAGGCTTTATGGCCCTGAAGTAGGAACCAGATGTCGGATACAGTTCACTTTAGCTACCC) sequences were cloned into pZW1-Sno Vector (Addgene plasmid #73174 ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by the mutated miR-15amut_16-1mut cluster and a construct encoding Cas9 (Addgene #52962).
-
bioRxiv - Microbiology 2023Quote: The miRNA over-expression plasmids and miR-92a mutation/deletion plasmids were obtained from Addgene vector repository ...
-
bioRxiv - Bioengineering 2023Quote: ... containing the primary or a fragment of the primary miR sequences were obtained from Addgene as stab cultures ...
-
bioRxiv - Neuroscience 2023Quote: ... TALE repeat arrays were assembled using the Joung Lab REAL Assembly TALEN kit (Addgene 1000000017). Synthesized TALEN mRNAs were injected into the cytoplasm of one-cell stage embryos ...
-
bioRxiv - Cancer Biology 2019Quote: ... MiR-146a over-expression cassette was sub-cloned from pU61 into the pLKO.1 TRC vector (Addgene plasmid #10878). Packaging plasmids psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and miR 128a were inserted into the 3’UTR of pMIR luciferase reporter (Life Scientific). miR-10b reporters described previously (Ma et al. 2007) were obtained from AddGene. Reporters were co-transfected with Renilla luciferase (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... the miR-30a-shRNA cassette was then amplified and inserted into pDIO-DSE-mCherry-PSE-MCS (gift from Beatriz Rico (Addgene plasmid #129669 ...
-
bioRxiv - Molecular Biology 2023Quote: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1 ...
-
bioRxiv - Systems Biology 2021Quote: ... individual drivers were PCR amplified out of the Cancer Pathways kit (Addgene #1000000072)21 ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 370 bp fragment of genomic DNA containing miRNA miR-34c was cloned into the Xho I and Mlu I restriction sites of the pLKO.1 vector (Addgene plasmid #52920) to express miR-34c (32) ...
-
bioRxiv - Genetics 2023Quote: ... EPP2 and RN2 cells were retrovirally transduced with shRNAmir constructs cloned into pMSCV-miR-E-PGK-Neo-IRES-mCherry backbone (LENC; Addgene plasmid #111163), and initial infection levels were determined by flow cytometry based on mCherry expression 4 days post transduction (day 0).
-
bioRxiv - Microbiology 2023Quote: ... or with the packaging plasmid pCD/NL-BH*deltavpu/RT-that lacks RT activity due to the D110E mutation in the catalytic site (kindly provided by Jakob Reiser; Addgene #136985). CA stability mutants P38A and E45A were kindly provided by Stephen Goff ...
-
bioRxiv - Developmental Biology 2021Quote: ... were designed on ZiFiT (http://zifit.partners.org/ZiFiT/) and constructed using the Joung Lab REAL Assembly TALEN kit (a gift from Keith Joung; Addgene, Cambridge, MA, #1000000017), according to the provided protocol (Sander et al. ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Bioengineering 2021Quote: ... the prime editor expression plasmid [SpCas9(H840A)-RT (Addgene no. 132775), FnCas9(H969A)-RT (developed in this study)] ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids encoding RT proteins used in OTTR are available from AddGene: 2Bc-T MBP_BoMoC(ed)_6xH (JumpPol ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCMV-PE2 plasmid expressing PE2 Cas9-RT fusion protein (Addgene plasmid #132775 ...
-
bioRxiv - Neuroscience 2021Quote: ... a gfp PCR product was PCR amplified from pPD95.75 (Addgene) using primers containing 35bp of overlap with the spop-1 gene immediately upstream of the predicted nuclear localization sequence ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into the pPD95.77 vector (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Neuroscience 2022Quote: ... for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml, Addgene) for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml ...
-
bioRxiv - Microbiology 2019Quote: ... pCR-BluntII-TOPO (Addgene #41824) (29) ...
-
bioRxiv - Biochemistry 2022Quote: ... The HTT expression constructs were assembled using the BD In-Fusion PCR cloning kit in the mammalian/insect cell vector pBMDEL (Addgene plasmid #111751), an unencumbered vector created for open distribution of these reagents.
-
bioRxiv - Immunology 2022Quote: ... PCR amplified HGS or VPS37A from U937 cDNA and PCR amplified mScarlet from pmScarlet_C1 (Addgene #85042) into pTRIP-SFFV-EGFP-NLS (Addgene #86677) ...
-
bioRxiv - Molecular Biology 2022Quote: PCR fragment with pY010 (Addgene #69982) as template and the following primers was cloned into pX458 (Addgene # 48138 ...
-
bioRxiv - Genetics 2022Quote: ... which we PCR amplified from Addgene plasmid #67639 ...
-
bioRxiv - Genetics 2022Quote: ... we PCR amplified NatMX from Addgene plasmid #35121 with the primers listed in Supplementary Table 6 using Phusion Hot Start Flex DNA polymerase (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... and pCR-24xPP7SL (Addgene, Cat.No. 31864) plasmids were double digested using SpeI and NotI restriction enzymes and the 24xMS2SL (1352bp ...
-
2P-NucTag: on-demand phototagging for molecular analysis of functionally identified cortical neuronsbioRxiv - Neuroscience 2024Quote: ... GCaMP7f was PCR-amplified from Addgene plasmid #104492 with a 3’ Primer that contained sequences encoding four Alanine residues and the 2PA sequence (both in frame with the coding sequence of GCaMP7f) ...
-
bioRxiv - Biophysics 2024Quote: ... emiRFP670 were PCR amplified from Addgene Plasmid #136571 (Matlashov et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were transfected a second time with 2μg pCBASceI plasmid (Addgene #26477) using PEI (Polysciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... the Cas9 and mCherry for detection of electroporated cells were obtained from Addgene (plasmids #66939, #66940, #66941). All targeting constructs (for both HDR and NHEJ ...
-
bioRxiv - Neuroscience 2023Quote: ... anesthetized RiboTag RT +/+ mice were bilaterally injected with AAV5-Cre viruses (AAV sterotype 5 AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540) at the following coordinates ...
-
bioRxiv - Immunology 2023Quote: ... The wzm – wbbO PCR product was assembled with PCR-linearized pBBR1MCS2 plasmid (Addgene, primers pBBR1-1F/pBBR1-1R) using an NEBuilder HiFi DNA Assembly kit (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... was PCR-amplified from plasmid pKIR1.1 (Addgene). Venus codon-optimized for expression in C ...
-
bioRxiv - Immunology 2020Quote: ... we PCR amplified TagRFP-Flag-cGAS (Addgene) by using RFP-cGAS-XbaI-F and cGAS-XhoI-R primers (Table S1) ...