Labshake search
Citations for Addgene :
401 - 450 of 961 citations for hsa mir 483 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... pLuc2-PromLDLR was created by PCR expansion of the target luciferase from pGL4Luc-RLuc (Addgene 64034), custom gene synthesis of the LDLR promoter (NCBI Reference Sequence NG_009060.1 ...
-
bioRxiv - Genetics 2020Quote: ... The BamHI/ XhoI digested NCL PCR product was cloned into BamHI/ XhoI digested pGPD2 (Addgene; #43972). The NCL-ΔRGG plasmid was similarly created using primers NCL-For and NCLΔRGG-1XHA Rev (Table S1) ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... The amplified PCR products were ligated to the NotI and SalI linearized MSCV vector (RRID: Addgene_17442). The MSCV murine ADAR2E396A expression construct was generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR-amplified ORF inserts were Gibson assembled into NcoI-HF- and XhoI-digested pET-21a(+) (Addgene) and then transformed into E ...
-
bioRxiv - Cell Biology 2022Quote: ... scFV-HAtag-sfGFP-GBI was PCR-amplified from pHR-scFv-GCN4-sfGFP-GB1-dWPRE (Addgene, #60907) and inserted between the NheI and HindIII sites of the pcDNA-puro vector.
-
bioRxiv - Cell Biology 2022Quote: ... strain MB921 was transformed with PCR product obtained using plasmid pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) and oligonucleotide primers Cut7-Cterm-pFA6a-GFP/paGFP-F and Cut7-Cterm-pFA6a-GFP/paGFP-R ...
-
bioRxiv - Cell Biology 2022Quote: ... strain MB1147 was transformed with PCR product obtained using plasmid pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) and oligonucleotide primers Cut7-988-Cterm-pFA6a-GFP-F (TTAAAGGGAACGACATCACTTGCTAATCATACTAATGAATTACTTGGTTTAG-GAGATGAACGGATCCCCGGGTTAATTAA ...
-
bioRxiv - Physiology 2022Quote: ... a DNA block containing sgEGFP-tRNA-Hnf4a-sg2 was PCR-amplified using pGTR plasmid (Addgene #63143) as a template and primers listed in Table S2 (see also Fig ...
-
bioRxiv - Synthetic Biology 2022Quote: ... was cloned by PCR amplifying both the mCherry from LLP469 pEF1a-mCherry-EMPTY-gRNA (Addgene, #100958) and the backbone of αGCN4-p65HSF1-CO ...
-
bioRxiv - Molecular Biology 2023Quote: ... full length BRCA1 was PCR-amplified from pCL-MFG-BRCA1 (Addgene #12341 (Ruffner and Verma, 1997)) with a triple Ty1-tag included in the reverse primer and subsenquently cloned into pENTR_1A and transferred to pCW57.1 using gateway cloning ...
-
bioRxiv - Neuroscience 2022Quote: ... T2A-QF2 including loxP-flanked 3xP3-RFP was PCR amplified from pBPGUw-HACK-QF2 (Addgene #80276), followed by insertion into pTOPO-acj6 right before the stop codon of acj6 by DNA assembly (New England BioLabs #E2621S) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The deaminase and UGI components in ciBE4max and ciAncBE4max were PCR-amplified from pCMV_BE4max (Addgene #112093) and pCMV_AncBE4max (Addgene #112094) ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were subsequently cloned into pExpTol2-UAS-E1B-ReaChR-TS-tagRFP-cryaa-mCherry (Addgene #43963) digested with SpeI and PacI using Hi-Fi DNA Assembly.
-
bioRxiv - Neuroscience 2023Quote: ... Both PCR products were assembled with the Tol2 Gateway plasmid backbone (pDestTol2pA2-U6:gRNA; Addgene #63157) using Hi-Fi DNA Assembly to obtain elavl3:hArr-TEV;he1.1:YFP.
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1_Signal-Flag-DRD2 was generated by PCR amplifying the DRD2 CDS from DRD2-Tango (Addgene #66269) (introducing a stop codon ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgi localisation signal (residues 3131 to 3259 of Human Giantin) was extracted by PCR from Addgene’s plasmid #85048 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The mCherry-3X-NLS sequence was PCR amplified from CSII-prEF1a-mCherry-3X-NLS (Addgene #125262). PCR fragments were assembled into pLenti6.3/V5-DEST-GFP
-
bioRxiv - Cell Biology 2023Quote: Lysosome localisation signal (residues 27 to 407 of Human LAMP1) was extracted by PCR from Addgene’s plasmid #55308 ...
-
bioRxiv - Genomics 2023Quote: ... with flanking sequences to enable PCR amplification and Gibson assembly into lentiGuide-Puro (pLG, Addgene #52963). The pooled oligo library was amplified using pLG_U6_foward 5’- GGCTTTATATATCTTGTGGAAAGGACGAAACACCG-3’ and pLG-TRACR_reverse 5’-GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: Mouse HA-Sox9-P2A and P2A-Cre blocks were PCR-amplified from pWPXL-Sox9 (Addgene, #36979) and AAV:ITR-U6-sgRNA(backbone)-TBG-Cre-WPRE-hGHpA-ITR(Katsuda et al. ...
-
bioRxiv - Cell Biology 2023Quote: Mouse HA-Sox4-P2A and P2A-Cre blocks were PCR-amplified from pLVXT-Sox4 (Addgene, #101121) and AAV:ITR-U6-sgRNA(backbone)-TBG-Cre-WPRE-hGHpA-ITR31 respectively ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product was digested with KpnI and XhoI and integrated into pSH1.6EGFP (Plasmid #42323, Addgene). The Flot1 gene was amplified from genomic DNA from YT16 rice using the primers HindIII_OsFlot1Prom1-F1 and Eco47III_OsFlot-R1 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1_Signal-Flag-HTR2A was generated by PCR amplifying the HTR2A CDS from HTR2A-Tango (Addgene #66409) (introducing a stop codon ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1_Signal-Flag-ADRB2 was generated by PCR amplifying the ADRB2 CDS from ADRB2-Tango (Addgene #66220) (introducing a stop codon ...
-
bioRxiv - Cell Biology 2023Quote: Keratin sequences were cloned by polymerase chain reaction (PCR) from pBabe-RFP1-KRT5-hygro (Addgene #58493) and pDONR22-KRT6A (DNASU clone HsCD00039474 ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
A quantitative characterization of early neuron generation in the developing zebrafish telencephalonbioRxiv - Developmental Biology 2023Quote: ... pCS2-Cre-ERT2 was generated by inserting PCR-generated ERT2 sequence (with pBigTB-CreERT2 (Addgene #149434) as template ...
-
bioRxiv - Neuroscience 2023Quote: ... oligonucleotide pairs (Extended Data Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... The NFAST sequence was amplified by PCR from the Addgene plasmid pAG148 FRB-NFAST (Addgene #130812) and ligated at the 3’ of ER-targeting sequence into pcDNA3.
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Cell Biology 2023Quote: ... The full-length and domain of interest were amplified by PCR using emGFP-BAZ1B (#65372; Addgene) as a template and inserted into pEGFP-C2 vector (Takara Bio ...
-
bioRxiv - Cell Biology 2023Quote: The VAPB-Wt expression vector was produced through PCR amplification using mCherry-VAPB (Addgene plasmid – 108126) as the template and the following primers ...
-
bioRxiv - Physiology 2023Quote: ... The PCR product was cloned via AgeI/BamHI into an MCS-BioID2-HA plasmid (Addgene #74224)15 to enable expression of an NCLX-BioID2-HA fusion protein under the control of a CMV promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... were cloned by PCR as EcoRI–BamHI fragments into the vector pcDNA3.1 mycBioID52 (Addgene plasmid #35700) in frame with BirA ...
-
bioRxiv - Molecular Biology 2023Quote: ... the MCP coding sequence was PCR amplified from UBC NLS-HA-2XMCP-tagRFPt vector (Addgene 64541) using MCP F and MCP R primers and inserted in-frame ...
-
bioRxiv - Developmental Biology 2023Quote: ... flanked by Xba1 sites was generated by touch down PCR using pUAST-Rab35-6myc (Addgene #53503) as template.
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR product was further digested using BamHI along with tol2kit 101_p5E-Ubiquitin plasmid (Addgene #27320). Both were purified and 101_p5E-Ubiquitin was dephosphorylated using NEB Antarctic phosphatase following manufacturer instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... was PCR-amplified from wt-TDP43- tdTomato-HA plasmid (Addgene 28205, a gift from Zuoshang Xu)63 and cloned in frame with the N-terminal 6- His-SUMO-TEV-site into the SspI site of pET 6His-SUMO-TEV LIC (1S ...
-
bioRxiv - Immunology 2024Quote: ... The OVA entry fragment was created using a PCR amplicon from OVA plasmid (Addgene plasmid 64599) with primers containing attB sites (Table 1 ...
-
bioRxiv - Bioengineering 2021Quote: ... The GoldenPiCS Kit was a gift from the Gasser/Mattanovich/Sauer group (Addgene kit #1000000133). All coding sequences were amplified with high-fidelity Phusion DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... Basic DNA parts were selected from GoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076) or MoClo Toolkit ...
-
bioRxiv - Developmental Biology 2023Quote: TALEN plasmids were constructed using the Platinum Gate TALEN Kit (Kit #1000000043, Addgene, Cambridge, MA) as previously described (Sakuma et al. ...
-
bioRxiv - Neuroscience 2020Quote: The TALEN kit used for TALE assembly was a gift from Keith Joung (Addgene kit # 1000000017). DNA fragments encoding ROSA TALEN repeat arrays were cloned into plasmid pJDS71 ...
-
bioRxiv - Plant Biology 2024Quote: We used zCas9i cloning kit: MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 (AddGene #1000000171). Sequence of all oligonucleotides and PCR primers used in this study are provided in Table S1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli codon optimized dSpyCas9 was PCR amplified from vector pdCas9 (gift from Luciano Marraffini, Addgene plasmid #46569) (43 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The resulting PCR product was subsequently cloned in the E1b-GFP-Tol2-Gateway construct (Addgene #37846; (71) by Gateway cloning ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR product was cloned into the BGlII/EcoR1 sites of the AAV-hSyn-EGFP (Addgene, 114213), upstream of the human Synapsin 1 promoter ...
-
bioRxiv - Genomics 2020Quote: ... The ORI minimal promoter and flanking region was PCR amplified from the hSTARR-seq plasmid (Addgene #99296) with a custom primer that included homology for Gibson cloning and KAPA HiFi HotStart ReadyMix (Kapa KK2602 ...
-
bioRxiv - Cell Biology 2020Quote: The doxycycline-inducible PLK4 plasmid was generated by PCR of the wild-type PLK4 cDNA from Addgene plasmid #41165 by PfuUltra II Fusion HS DNA polymerase (Agilent #600670. ...