Labshake search
Citations for Addgene :
251 - 300 of 960 citations for hsa mir 146a Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... The AQP1-miniIAA7 and AQP1-AID expressing cell lines were transduced a second time with lentivirus encoding AtAFB2 (Addgene 129718) and OsTIR1 (Addgene 72834 ...
-
bioRxiv - Neuroscience 2024Quote: Time-pregnant wild-type C57BL/6J female mice underwent in utero virus injection of CamkII-cre virus (105558-AAV1, Addgene) into the left side of the lateral ventricles ...
-
bioRxiv - Cell Biology 2020Quote: ... Other gene deletions were generated using PCR products derived from pFA6a-kanMX6 (Addgene 39296) or pFA6a-hphNT1 (Euroscarf P30347 ...
-
bioRxiv - Cell Biology 2020Quote: mCherry-ER fusion protein was amplified by PCR from mCherry-ER-3 plasmid (Addgene) and cloned into Gateway modified pBABE (in house) ...
-
bioRxiv - Molecular Biology 2021Quote: ... emiRFP2 were PCR amplified and swapped with miRFP670nano in pKeratin-miRFP670nano plasmid (Addgene #127437) using Fusion cloning (Takara) ...
-
bioRxiv - Molecular Biology 2020Quote: ... crRNA linked with TRACR (sgRNA) were amplified by PCR with a pLKO vector (Addgene_52628) as template ...
-
bioRxiv - Genetics 2020Quote: ... Gal4 5’ and 3’ homology arms were PCR-amplified using pDEST-APIGH (Addgene # 112804) as the template ...
-
bioRxiv - Cancer Biology 2019Quote: ... by PCR and subcloning the product into the pENTR1A-GFP-N2 vector (Addgene # 9364) at the HindIII and BamH1 restriction sites ...
-
bioRxiv - Bioengineering 2021Quote: ... were PCR amplified from PmCDA1-1x uracil-DNA glycosylase inhibitor protein (UGI) (Addgene #79620), evoCDA1 pBT277 (Addgene #122608) ...
-
bioRxiv - Plant Biology 2021Quote: ... Gel-purified PCR product and SspI-digested pET-His6-MBP-TEV-LIC vector (Addgene) were treated with T4 DNA polymerase with 25 mM dCTP and dGTP for 30 min at 22°C followed by heat inactivation ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was subcloned into pJFRC19-13XLexAOP-IVS-myr::GFP vector (Addgene#26224) to generate pJFRC19-13XLexAOP-yki3S/A ...
-
bioRxiv - Genetics 2022Quote: ... mouse cGAS was amplified via PCR from a pMSCVpuro-eGFP-cGAS template (Addgene, 108675) using primers containing KpnI and NotI restriction sites (S1 Table) ...
-
bioRxiv - Microbiology 2020Quote: ... dTomato gene was amplified by PCR from pLenti-V6.3 Ultra-Chili (Addgene plasmid # 106173) using primers dTomato_F_EEV and dTomato_linker_R_BH ...
-
bioRxiv - Molecular Biology 2021Quote: ... iRFP720 was obtained by PCR from iRFP720-N1 (gift from Vladislav Verkhusha, Addgene #45461).
-
bioRxiv - Neuroscience 2021Quote: ... TVA-mCherry was amplified by PCR from a plasmid (gift from Dr. Uchida, Addgene plasmid #38044 ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Cell Biology 2022Quote: ... Strep-KDEL was PCR amplified from Strep-KDEL-SBP-mCherry-GPI (Addgene plasmid #65295) and assembled to a BamHI/PsrI digested TtTMPV-Neo viral backbone (Addgene plasmid #27993) ...
-
bioRxiv - Genomics 2019Quote: ... The dLbuCas13 gene was amplified by PCR from the Lbu_C2c2_R472A_H477A_R1048A_ H1053A plasmid (Addgene #83485). The ADAR1DD (hyperactive E1008Q variant ...
-
bioRxiv - Genetics 2020Quote: ... The U6:3 promoter was PCR amplified from pAC-U63-tgRNA-Rev (Addgene #112811). The CR7T promoter was synthesized as a gBlock DNA fragment (IDT ...
-
bioRxiv - Cell Biology 2019Quote: ... and TIR1 sequence were amplified by PCR from pcDNA5-EGFP-AID-BubR1 (Addgene #47330) and pBABE TIR1-9Myc (Addgene #47328)30 plasmids ...
-
bioRxiv - Neuroscience 2020Quote: ... sequences were amplified by overlap PCR and subcloned into the AAV-CAG-GFP (Addgene) at BamHI and EcoRI ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The LOV2 domain was PCR amplified from the vector CMV-CASANOVA (Addgene plasmid #113035) previously reported by us (29) ...
-
bioRxiv - Cancer Biology 2019Quote: ... the KRAB domain was PCR amplified using pHR-SFFV-dCas9-BFP-KRAB (Addgene #46911) as a template ...
-
bioRxiv - Cell Biology 2021Quote: LAMP1-GFP was amplified using PCR (using primers listed in Table S2) from Addgene plasmid #34831 and then cloned into lentiviral vector FUGW (Addgene plasmid #14883 ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: ... and 1039–1176) were PCR-amplified using the full-length Prdm16 plasmids (Addgene #15503) and sub-cloned into XbaI/EcoRI sites of Flag-HA-pcDNA3.1 vector (Addgene #52535) ...
-
ER exit sites in Drosophila display abundant ER-Golgi vesicles and pearled tubes but no megacarriersbioRxiv - Cell Biology 2021Quote: ... the APEX sequence was PCR-amplified from plasmid pcDNA3 APEX2-NES (Addgene, cat # 49386) with primers attNheIAPEX-F and attSpeIAPEX-R adding att sites ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR amplified ScTop2 and HsTOP2α cDNAs were inserted into the 12URA-B (Addgene #48304) yeast expression vector while HsTOP2β was inserted into the 12URA-C (Addgene #48305 ...
-
bioRxiv - Cell Biology 2022Quote: ... OMP25 was PCR amplified from paGFP-Omp25 (gift from D. Sabatini, Addgene plasmid #69598) and cloned with XhoI/BamHI into mMaple-C1 ...
-
bioRxiv - Cell Biology 2022Quote: ... RA was PCR amplified from RA-NES (gift from R. Campbell, Addgene plasmid #61019) (Ding et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... GB was PCR amplified from GB-NES (gift from R. Campbell, Addgene plasmid #61017) (Ding et al. ...
-
bioRxiv - Immunology 2022Quote: ... An amino-terminal 3xFlag epitope tagged human GLUT3 was generated by PCR (Addgene #72877) (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was constructed by PCR amplifying the sacB gene of pACRISPR (Addgene plasmid #113348) (Chen et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... EXO1 was PCR amplified from pTXB1-EXO1b (Addgene #68267 (El-Shemerly et al., 2005)) and transferred directly into pCW57.1 using Gibson Assembly.
-
bioRxiv - Molecular Biology 2022Quote: ... The M-MLV* reverse transcriptase in ciPE2 was PCR-amplified from pCMV_PE2 (Addgene #132775), a gift from David Liu ...
-
bioRxiv - Molecular Biology 2022Quote: ... The deaminase components in ciABEmax and ciABE8e were PCR-amplified from pCMV_ABEmax (Addgene #112095) and pCMV_ABE8e (Addgene #138489) ...
-
bioRxiv - Microbiology 2023Quote: ... The backbone vector pLVX-EF1alpha-2xStrep-IRES-Puro was linearized by PCR from Addgene plasmid # 141395 with primers pLVX-EF1alpha_Fw (ctcgaaggcggcggg ...
-
bioRxiv - Molecular Biology 2023Quote: ... The CDS for AGO1 and GW182 were PCR amplified from pAFW-Ago1 (Addgene #50553) and LD47780 (DGRC ...
-
bioRxiv - Cell Biology 2023Quote: ... the H2B-mRFP1 sequence was amplified by PCR from pLV-RFP (Addgene #26001 (39)) and inserted using Gibson assembly in place of GFP into vector pEGFP-C1 (Clonetech ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA templates for PCR products were as follows - myo-3p from pCFJ104 (Addgene #19328), pgl-1::GFP::FLAG from DUP75 (Andralojc et al. ...
-
bioRxiv - Cancer Biology 2023Quote: Full length murine Tnf was PCR amplified from GFP-TNF-alpha plasmid (Addgene #28089) via Phusion PCR according to manufacturer’s protocol with the following primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Canada) was amplified by PCR and inserted into the retroviral vector pBABE-puro (Addgene) containing the puromycin-resistance gene and the MoMuLV LTR promoter ...
-
bioRxiv - Microbiology 2023Quote: ... PCR was performed using a plasmid VCP (wt)-EGFP gifted from Nico Dantuma (Addgene plasmid # 23971 ...
-
bioRxiv - Cell Biology 2023Quote: ... The corresponding PCR product was subsequently cloned into linearised tdTOMATO-C1 plasmid (Addgene #54653), before transfected into ECs by electroporation.
-
bioRxiv - Synthetic Biology 2023Quote: ... FusionRed-PixD and Citrine-PixE were produced by PCR using existing templates (Addgene #31181), (Addgene #111503 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The first fragment came from PCR amplification of pETM6-HCAmp-EV (Addgene Cat#49795) with primers JNH13 and JNH14 ...
-
bioRxiv - Biochemistry 2023Quote: ... Then PCR products were Gibson-cloned into the PEmax mRNA plasmid (Addgene plasmid #204472) digested with RsrII and XhoI enzymes ...
-
bioRxiv - Cancer Biology 2023Quote: The LIG1 open reading frame (ORF) was amplified by PCR from pDONR223_LIG1_WT_V5 (Addgene, 83006) and cloned into the pOZ-FH-C vector ...
-
bioRxiv - Genomics 2023Quote: ... and the URA3 cassette was amplified by PCR from plasmid pWS158 (Addgene plasmid #90517). The amplified DNA fragments ...
-
bioRxiv - Neuroscience 2024Quote: ... pCAG 4xmt-iATPSnFR1.0 was created by PCR of the DNA encoding iATPSnFR1.0 from Addgene Plasmid #102556 (a gift from Baljit Khakh) ...
-
bioRxiv - Genomics 2022Quote: ... elegans Vector Kit was a gift from Andrew Fire (Addgene kit # 1000000001). A translational reporter was later generated by synthesizing the remainder of the coding sequence (IDT ...