Labshake search
Citations for Addgene :
151 - 200 of 1909 citations for T Cell Surface Glycoprotein CD3 Gamma Chain CD3G Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 0.6 mm rostral relative to bregma and at two depths - 0.7 and 0.35 mm from the cortical surface) followed by an injection of pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA (Addgene 68717-AAV1; 1.8×1013 GC/ml) into right motor cortex (1.6 mm lateral ...
-
bioRxiv - Cell Biology 2019Quote: ... Addgene Plasmid 44842 (pFA6a-link-yoTagRFP-T-SpHis5) was a gift from Wendell Lim & Kurt Thorn (Addgene plasmid # 44842; http://n2t.net/addgene:44842; RRID:Addgene_44842).
-
bioRxiv - Microbiology 2019Quote: ... They were immortalized by transduction with a retroviral vector encoding SV40 large T antigen (pBABE-zeo largeTcDNA, Addgene). The Atf6+/+ vs ...
-
bioRxiv - Biophysics 2022Quote: ... pET His6 LIC cloning vector (2Bc-T) was a gift from Scott Gradia (Addgene plasmid # 37236; http://n2t.net/addgene:37236; RRID:Addgene_37236). 2A-protease in 2Bc-T plasmid was expressed as described for the 2G-T-plasmid expressed proteins ...
-
bioRxiv - Biophysics 2022Quote: ... pET His6 GST TEV LIC cloning vector (2G-T) was a gift from Scott Gradia (Addgene plasmid # 29707; http://n2t.net/addgene:29707; RRID:Addgene_29707). Single ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary MEFs were then immortalized by transient transfection with a plasmid expressing SV40 large T antigen (Addgene #21826). Single cell clones were then isolated by limiting dilution ...
-
bioRxiv - Biochemistry 2022Quote: Human SERPINE1 cDNA was subcloned from pAY-FE-PAI-1 using ligation independent cloning into the pET Flag TEV LIC cloning vector (2L-T, a gift from Scott Gradia—Addgene plasmid #29175; http://n2t.net/addgene:29715; RRID:Addgene_29715) using primers pET PAI-1 LIC For and pET PAI-1 LIC Rev (SI Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagRFP-T-Clathrin-15 was a gift from Michael Davidson (Addgene plasmid # 58005; http://n2t.net/addgene:58005; RRID:Addgene_58005) (Shaner et al ...
-
bioRxiv - Neuroscience 2023Quote: ... Polycistronic CRISPR plasmids pX33075 and pX45876 were optimized so that one vector contained two U6 promotors with two sgRNA sequences.39 Guide RNA sequences were chosen as described.77,78 The DNA sequence encoding the TagRFP-T_A1aY1 Tyr-T sensor was amplified from Addgene plasmid #158751 (a gift from Minhajuddin Sirajuddin43 ...
-
bioRxiv - Biophysics 2023Quote: ... or an N-terminal TEV protease-cleavable His6-tag (UC Berkeley Macrolab vector 2B-T, Addgene ID 29666). For coexpression ...
-
Mapping of the autophagosomal degradome identifies IL-7Rα as key cargo in proliferating CD4+ T-cellsbioRxiv - Immunology 2021Quote: P-Lenti CMV/TO SV40 small + Large T (w612-1) was a gift from Eric Campeau (Addgene plasmid # 22298). For packaging the virus ...
-
bioRxiv - Genetics 2019Quote: ... was generated by replacing the CMV promoter in plasmid pscAAV-GFP (gift from John T Gray, Addgene, Cat#32396) with the CAG promoter derived from pAAV-CAG-GFP (gift from Edward Boyden ...
-
bioRxiv - Neuroscience 2019Quote: pAAV-CaMKIIa-ChR2(H134R)-EYFP and pAAV-CaMKIIa-hChR2(E123 T/T159C)-EYFP (Addgene, Watertown, USA #26969 and #35511) were gifts from Karl Deisseroth ...
-
bioRxiv - Biophysics 2021Quote: ... The pET MBP His6 LIC cloning vector (2Cc-T) was a gift from Scott Gradia (Addgene plasmid # 37237; http://n2t.net/addgene:37237; RRID: Addgene_37237).
-
bioRxiv - Cell Biology 2020Quote: ... RNP complex (Cas9 with tracrRNA for LMNB1 gene) (IDT) and 400 ng of LMNB1_mTagRFP-T HDR plasmid (Addgene 114403). Nucleofection was done with the pulses DN-100 ...
-
bioRxiv - Cell Biology 2022Quote: Constructs used were: Mito-DsRed2 (kindly provided by T. Schwarz, Harvard Medical School, Boston) and Mito-SBFP2 (Addgene #187964); untagged Parkin (Addgene #187897) ...
-
bioRxiv - Cancer Biology 2019Quote: Arachnoid cells were immortalized using a lentivirus harboring the SV40 large T antigen [pBABE-puro SV40 LT was a gift from Thomas Roberts (Addgene, RRID:Addgene_13970) as previously described (48) ...
-
bioRxiv - Microbiology 2020Quote: ... The CD4 expression vector pMX-CD4 and the TR expression vector pMD18-T TR were from Addgene (Watertown, MA) and Sino Biological Inc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... CdtB was cloned into the pET His6 TEV vector 2B-T (a gift from Scott Gradia, Addgene plasmid #29666) using sequence and ligation-independent cloning (SLIC ...
-
bioRxiv - Molecular Biology 2022Quote: ... early passage primary MEFs from all genotypes were infected in parallel with the SV40 large T antigen (Addgene:13970) (Zhao et al. ...
-
bioRxiv - Neuroscience 2023Quote: Wild type Drosophila and human spectrins were cloned into a histidine tagged vector (2BC-T cloning vector, Addgene # 31070) using ligation independent cloning to obtain C-terminally tagged proteins ...
-
bioRxiv - Biochemistry 2023Quote: ... and pET His6 TEV LIC cloning vector (2A-T, a generous gift from the Scott Gardia lab) (Addgene # 29665) using Ligation Independent Cloning to generate the pAKTB-α and pAKTB-β plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids expressing murine PKA (mPKA) RIIα and ER membrane targeting signal fused miniTurbo promiscuous biotin ligase (ER-mTb) were obtained from Addgene (#45527 and #107174, respectively). The mPKA RIIα sequence was PCR amplified and cloned into the upstream of the mTb sequence ...
-
bioRxiv - Neuroscience 2020Quote: T A-QF2-SV40-3xP3-dsRed with QF2 and dsRed open reading frame from ppk301-T2A-QF2 (Addgene plasmid #130667) (Matthews et al. ...
-
bioRxiv - Biophysics 2021Quote: ... and immortalized by transduction with a retrovirus expressing SV40 T antigen from pBABE-puro SV40LT (pBABE-puro SV40LT was a gift from Thomas Roberts (Addgene plasmid # 13970 ...
-
bioRxiv - Neuroscience 2022Quote: ... CMV mScarlet-LC3B (subcloned from EGFP-LC3B, gift from T. Yoshimori, Osaka University, Japan, with mScarlet from Addgene plasmid #85054), CMV EGFP-PPM1H-WT (#DU62939 ...
-
bioRxiv - Biochemistry 2022Quote: Human SERPINE1 cDNA was subcloned from pAY-FE-PAI-1 using ligation independent cloning into the pET Flag TEV LIC cloning vector (2L-T, a gift from Scott Gradia—Addgene plasmid #29175 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pFA6a-link-yoTagRFP-T-Kan (Lee et al., 2013) was a gift from Wendell Lim & Kurt Thorn (Addgene 44906); both were given in the form of bacterial stabs ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either the inhibitory opsin archaerhodopsin T (ArchT; N = 11; 6 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Immunology 2021Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vectors 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) or 2C-T (AmpR ...
-
bioRxiv - Biochemistry 2020Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vector 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) for expression in E ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’CACCGTGCAGCCCCCATAGCAGGTG and 5’AAACCACCTGCTATGGGGGCTGCAC) were synthesized by ID&T (Leuven, Belgium) and cloned into the pSpCas9(BB)-2A-Puro plasmid (pXP459, Addgene #48139). HeLa cells were co-transfected with the two RNF213-targeting plasmids with Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Synthetic Biology 2022Quote: The plasmids for Dox-inducible expression of the ddGFP PAR-T constructs were generated using a cDNA for ddGFP-A (Addgene, 40286) or ddGFP-B (Addgene ...
-
bioRxiv - Biophysics 2022Quote: For biolayer interferometry experiments protease 2A from CV-B3 was sub-cloned into LIC cloning vector 2Bc-T (Addgene plasmid # 37236) with a C-terminal His6-tag ...
-
bioRxiv - Cell Biology 2022Quote: ... was made by replacing the luciferase sequences with the fluorescent protein T-Sapphire in pHAGE NFKB-TA-LUC-UBC-dTomato-W (Addgene #49335). Additionally we replaced the marker tdTomato in Addgene #49335 with the resistance cassette for HygromycinB ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Cancer Biology 2019Quote: Arachnoid cells were immortalized using a lentivirus harboring the SV40 large T antigen [pBABE-puro SV40 LT was a gift from Thomas Roberts (Addgene, RRID:Addgene_13970) as previously described (48) ...
-
bioRxiv - Plant Biology 2020Quote: ... FolSIX418-242 and FolSIX617-225) and were introduced into either the pET His6 Sumo TEV LIC cloning vector (2S-T; Addgene #29711) or the modified ...
-
bioRxiv - Developmental Biology 2020Quote: ... The delCTCF(CS38) and inv(T-DOM) alleles were generated after cloning the gRNAs into the pX330:hSpCas9 (Addgene ID 42230) vector and DNA injection into pronuclei ...
-
bioRxiv - Cell Biology 2021Quote: Fragments of Cnn-C-N and Cnn-T-N used in co-IP experiments were amplified from the pDONR-Cnn-C and pDONR-Cnn-T vectors described above by PCR and inserted into a pDEST-HisMBP (Addgene, #11085) vector by Gateway cloning (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... N3 (residues 365-419) was similarly inserted into UC Berkeley Macrolab vector 2C-T (AmpR, N-terminal His6-MBP fusion; Addgene #29706). Plasmids were transformed into E ...
-
bioRxiv - Biochemistry 2020Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vector 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) for expression in E ...
-
bioRxiv - Cell Biology 2023Quote: ... the nucleotide sequence of pEGFP-Mieap between the Nhe I and Xho I restriction sites containing EGFP was replaced with nucleotide sequence of pTagRFP-T-EEA1 (Addgene #42635) between the Nhe I and Xho I restriction sites containing TagRFP-T ...
-
bioRxiv - Biochemistry 2023Quote: ... The PrcA and PrcB genes were sub-cloned in the pET His6 TEV LIC cloning vector (2B-T, a generous gift from the Scott Gardia lab) (Addgene# 29666) and pET His6 TEV LIC cloning vector (2A-T ...
-
bioRxiv - Neuroscience 2023Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5×1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Biochemistry 2021Quote: ... and p53 TAD (13-61) were subcloned into the pET His6 GST TEV LIC cloning vector (2G-T) (a gift from Scott Gradia, Addgene plasmid #29707) and transformed into E ...
-
bioRxiv - Biochemistry 2021Quote: ... and p53 DBD (94-312) were subcloned into the pET His6 TEV LIC cloning vector (2B-T) (a gift from Scott Gradia, Addgene plasmid #29666) and transformed into E ...
-
bioRxiv - Cell Biology 2021Quote: ... pLBR08 was generated via Gibson assembly of PCR-amplified LAMP1 cDNA (from mTagRFP-T-Lysosomes-20 acquired from Nikon Imaging Center at UCSF, Addgene plasmid #58022) and PCR-amplified XTEN80-mEGFP-3xHA immunoprecipitation tag with a linearized backbone generated from ClaI and BspDI (New England BioLabs cat ...
-
bioRxiv - Cancer Biology 2019Quote: ... the wild-type and Δ365-371 mutant CELF1 were cloned in the pET His10 TEV LIC cloning vector (2B-T-10) (Addgene, Cambridge, MA) using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding a fragment of human Archease (Uniprot Q8IWT0) spanning residues 27−167 was cloned into the UC Berkeley MacroLab 2M-T vector (gift from Scott Gradia, Addgene plasmid #29708) to express a fusion protein containing an N-terminal His6 tag ...