Labshake search
Citations for Addgene :
1 - 50 of 1909 citations for T Cell Surface Glycoprotein CD3 Gamma Chain CD3G Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Gamma (Addgene # 170450), Delta (Addgene # 172320) ...
-
bioRxiv - Immunology 2024Quote: ... The murine CD3 WTdelta-F2A-gamma-T2A-epsilon-P2A-zeta pMIA II plasmid was a gift from Dario Vignali (Addgene plasmid # 52093) [40] ...
-
bioRxiv - Cell Biology 2021Quote: ... Single-chain antibodies fused to GFP (scAB-GFP, Addgene #104998) were used for imaging translation sites through nascent polypeptide labeling ...
-
bioRxiv - Neuroscience 2023Quote: ... and VSV g-glycoprotein Env (pMD2.G Addgene: 12259), together with pLentiRhoA2G (Addgene ...
-
bioRxiv - Biochemistry 2021Quote: ... and pMD2.G envelope glycoprotein vector (Addgene cat no. 12259) into HEK293 cells using Lipofectamine 2000 and maintained in DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... and the VSVG envelope glycoprotein vector pMD2-G (Addgene plasmid #12259) into HEK293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with mCherry – clathrin light chain B (Addgene Plasmid #55019) and EGFP – clathrin light chain A52 plasmids ...
-
bioRxiv - Cell Biology 2020Quote: The ATF4-SunTag reporter was stably integrated into a previously-described HeLa-11ht cell line stably expressing GFP-tagged single-chain antibodies (scFvGFP) against GCN4 (Addgene plasmid #104998) and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Vesicular Stomatitis Virus glycoprotein (VSV-G) envelope expression vector (pMD2.G; Addgene #12259), lentiviral packaging plasmid (psPax2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Neuro2a cells stably expressing the CVS-N2c glycoprotein (N2A-N2cG_02 cells) were transfected with the barcoded N2c library along with helper plasmids pCAG-N2cN (Addgene cat. # 100801), pCAG N2cP (Addgene cat ...
-
bioRxiv - Immunology 2023Quote: ... Amplicon from the first PCR reaction were used as templates for cloning into antibody expression vectors (Abvec2.0-IGHG1 for the heavy chain and Abvec1.1-IGKC or Abvec1.1.-IGLC2-XhoI for of the light chains, all from AddGene).
-
bioRxiv - Bioengineering 2024Quote: ... pcDNA3.1-Tras heavy chain-SpyTag003 (‘Tras NoLink’) and pcDNA3.1-Tras light chain (GenBank and Addgene deposition in progress) were cloned previously by Jamie Lam (University of Oxford ...
-
bioRxiv - Neuroscience 2020Quote: GFP-PIPK1 gamma 90 was a gift from Pietro De Camilli (Addgene plasmid # 22299 ...
-
bioRxiv - Cell Biology 2022Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 104433 ...
-
An in vitro platform for quantifying cell cycle phase lengths in primary human intestinal stem cellsbioRxiv - Cell Biology 2023Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid #104433 ...
-
bioRxiv - Neuroscience 2023Quote: ... with the SAD B19 glycoprotein gene from pCAG-B19G (Chatterjee et al., 2018) (Addgene 59921) and either the mCre ...
-
bioRxiv - Biochemistry 2023Quote: ... and actin (pACEBac1-gamma-TuRC-GFP) were a gift from Tarun Kapoor (Addgene plasmid # 178079 ...
-
bioRxiv - Biophysics 2023Quote: ... biotin ligase (BirA; Addgene#109424) was expressed in E ...
-
bioRxiv - Neuroscience 2020Quote: ... In this plasmid the DIO-GFP sequence was replaced by C1V1(t/t)-TS-mCherry from the rAAV CaMKIIa-C1V1(t/t)-TS-mCherry (Addgene, plasmid #35500).
-
bioRxiv - Immunology 2021Quote: ... creating pMY-CD3-P2A-CD90.2 (Addgene: #163338). The full CD3-CD90.2 insert was further subcloned into the pMX vectors with different promoters using BamHI and HindIII (Addgene #163334-7).
-
bioRxiv - Cancer Biology 2021Quote: ... and single-chain gRNA encoding plasmid (MLM3636, AddGene #43860) were gifts from Keith Joung ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP-PIPK1 gamma 90 was a gift from Pietro De Camilli (Addgene plasmid # 22299) and subcloned with mScarlet-I into mammalian expression plasmids ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids encoding the spike glycoprotein of vesicular stomatitis virus (VSV-G) and Cas9 were obtained from Addgene (cat ...
-
bioRxiv - Cell Biology 2020Quote: ... Jurkat T cells were transfected with mTurquoise-Farnesyl-5 plasmid (#55551, Addgene) 24 hours prior to the assay ...
-
bioRxiv - Cell Biology 2024Quote: ... The T-REx293 cell line was transiently transfected with LentiCRISPRv2 (Addgene, #52961). The sgRNA sequences used for cloning LentiCRISPRv2-DHHC5 were ...
-
bioRxiv - Neuroscience 2020Quote: ... engineered and optimized glycoprotein (oG) [76] sequence was ligated to pAAV-FLEX sequence from pAAV-FLEX-GFP (Addgene).
-
bioRxiv - Neuroscience 2020Quote: ... or 400nl of AAV9-CaMKIIa.C1V1(t/t).TS.EYFP (≥1013 CG/ml, Addgene). Orexin promoter virus expression specificity has been characterized previously (González et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... TagRFP-T (Addgene #122200) or iRFP670 (Addgene # 122182 ...
-
bioRxiv - Neuroscience 2020Quote: ... bacterial biotin ligase BirA-ER from Addgene #20856 was subcloned into a CFP-P2A expressing shuttle vector to form f(syn)CFP-P2A-BirA-ER ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral packaging plasmid psPAX2 and pMD2.G encoding the vesicular stomatitis virus glycoprotein were gifts from Didier Trono (Univ. of Geneva) and purchased from Addgene (http://n2t.net/addgene:12260 and http://n2t.net/addgene:12259 ...
-
bioRxiv - Immunology 2020Quote: ... pCMV-VSV-G plasmid encoding for the vesicular stomatitis virus glycoprotein was a gift from Bob Weinberg (Addgene plasmid #8454). LeGO-G2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... immortalized MEFs (transduced with large T and small T expressing lentivirus (Plasmid #22298, Addgene) were transduced with an H2B-Neon expressing lentivirus (pLV-H2B-Neon-ires-Puromycin)74,75 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1 was a gift from Christopher Harvey (Addgene viral prep # 124650-AAV9 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2G-T (Addgene plasmid #29707), 2GFP-T (Addgene plasmid #29716) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2GFP-T (Addgene plasmid #29716), and co-transformation vector 13S-A (Addgene plasmid 48323) ...
-
bioRxiv - Cell Biology 2019Quote: HeLa cells were transfected with GFP-ITSN2-S and TagRFP-T-EEA1 (Addgene, reference: 42635) and observed under spinning disk microscope (Zeiss Axio Observer Z1 with a Yokogawa CSU X1 confocal head ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Microbiology 2021Quote: ... Flag-tagged full-length Human gamma-catenin construct in the pcDNA3 vector was obtained from Addgene (plasmid #16827).
-
bioRxiv - Cell Biology 2022Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 104433 ; http://n2t.net/addgene:104433; RRID:Addgene_104433)49
-
bioRxiv - Biochemistry 2023Quote: ... and actin (pACEBac1-gamma-TuRC-GFP) were a gift from Tarun Kapoor (Addgene plasmid # 178079 ; http://n2t.net/addgene:178079 ; RRID:Addgene_178079). Plasmids were transformed into DH10MultiBacTurbo cells (ATG:biosynthetics GmbH ...
-
An in vitro platform for quantifying cell cycle phase lengths in primary human intestinal stem cellsbioRxiv - Cell Biology 2023Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid #104433; http://n2t.net/addgene:104433; RRID:Addgene_104433), and pmScarlet_H2A_C1 was a gift from Dorus Gadella (Addgene plasmid #85051 ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for amino acids 1-110 of GCP2 were PCR amplified from pACEBac1-gamma-TuSC (a gift from Tarun Kapoor (Addgene plasmid # 178079 ; http://n2t.net/addgene:178079 ; RRID:Addgene_178079)) using the following primers ...
-
bioRxiv - Pathology 2020Quote: ... Lentiviral vector pLV-mCherry and vesicular stomatitis virus glycoprotein (VSV-G) expression vector pMD2.G were obtained from Addgene (Watertown, MA, USA). Coding sequence of SARS-CoV-2 S gene (GenBank ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Neuroscience 2020Quote: GFP-PIPK1 gamma 90 was a gift from Pietro De Camilli (Addgene plasmid # 22299; http://n2t.net/addgene:22299; RRID: Addgene_22299). GABA (A ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transduced by thermosensitive retroviral gene transfer of SV40 T antigen (LOX-CW-CRE, Addgene) at a MOI of 5 in Proliferation UREC medium with 8μg/mL polybrene (64) ...
-
bioRxiv - Immunology 2023Quote: ... mouse naïve CD4+ T cells were transfected with p8xEGFP-N1 (Addgene # 122168, gift from Georg Mayr) which expresses 8 concatemeric EGFP proteins ...
-
bioRxiv - Cell Biology 2020Quote: ... EEA1 TagRFP-T (Addgene plasmid #42635), a gift from Silvia Corvera ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected AAV9-CaMKIIa.C1V1(t/t).TS.EYFP (titer: 2.3 × 1013 GC/ml; prepared by Addgene, MA, USA) into the unilateral dorsal hippocampus as described previously 87.
-
bioRxiv - Molecular Biology 2019Quote: ... 293T cells were cotransfected with vectors encoding an RNA bait flanked by BoxB stem loops and the BASU biotin ligase (Addgene #107253 and #107250 ...