Labshake search
Citations for Addgene :
251 - 300 of 946 citations for RatCol 8 mg ml type I collagen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: Time-pregnant wild-type C57BL/6J female mice underwent in utero virus injection of CamkII-cre virus (105558-AAV1, Addgene) into the left side of the lateral ventricles ...
-
bioRxiv - Neuroscience 2020Quote: ... Eed-pcDNA was described previously by us (8) and Kdm6b-pcDNA was obtained from Addgene (Plasmid # 24167). Each mix was transferred to a Nucleocuvette and electroporated using the 4D-nucleofector Core Unit (LONZA ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-9 20 nL injections of AAV1-Syn-flex-GCaMP6s (Addgene #100845-AAV1, Chen et al., 2013) were delivered to the RSC (AP ...
-
bioRxiv - Biochemistry 2021Quote: ... P1-8 and Photobacterium damselae were cloned into pNIC28-Bsa4 (N-terminal polyhistidine tag; Addgene #26103 (60)) ...
-
bioRxiv - Biochemistry 2024Quote: ... mCherry-EB1-8 was a gift from Michael Davidson (Addgene plasmid #55035, http://n2t.net/addgene:55035 ; RRID:Addgene_55035). Imaging was performed 24 hours after transfection.
-
bioRxiv - Cell Biology 2024Quote: ... The CRISPR-assisted insertion tagging system (CRISPaint) 8 plasmid (pCRISPR-HOT-Clover- BlastR) was obtained from Addgene (Plasmid #138569 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lck-mScarlet-I was a gift from Dorus Gadella (Addgene plasmid #98821; http://n2t.net/addgene:98821; RRID:Addgene_98821). Digital plasmid maps are available upon request.
-
bioRxiv - Cell Biology 2023Quote: ... and mScarlet-I-GRASP65 under the control of CMV promoter were generated from mCherry-ST (Addgene#55133), iRFP713 (Addgene#31857) ...
-
bioRxiv - Microbiology 2023Quote: ... The gene coding mScarlet-I was amplified from the plasmid Double UP mNeongreen to mScarlet (Addgene #125134) by PCR using primers P1214 and P1215 and cloned into the EcoRV linearized pHYX137 by IVA in E ...
-
bioRxiv - Systems Biology 2024Quote: ... The GFP encoding gene of pJMP6957 was replaced by an mScarlet-I encoding gene derived from Addgene plasmid 85069 (pJMP7001 ...
-
bioRxiv - Cancer Biology 2024Quote: ... in 200 uL of OptiMEM with 0.8 ug of the I-SceI expression plasmid (pCBASce, Addgene #60960). The media was replaced the next morning and the cells were trypsinized 48-hours post-transfection for analysis of GFP expression by flow cytometry (BD Biosciences).
-
bioRxiv - Biochemistry 2020Quote: HEK293T CRISPR-Cas9 cells were generated by transfecting wild-type 293T cells with pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene, Plasmid# 42230) carrying single-guide RNA (sgRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Cancer Biology 2022Quote: MIA PaCa-2 wild type (WT) and TSC1/TSC2 knockout (KO) cells were transduced with retrovirus expressing RFP (pQCXIP-turboRFP, Addgene #73016) or EGFP (pQCXIP-EGFP-F ...
-
bioRxiv - Microbiology 2023Quote: HPV16 PsVs were produced by co-transfecting 293TT cells with wild-type p16SheLL-3XFLAG tag [14] together with pCAG-HcRed (Addgene #11152) or pCINeo-GFP [obtained from C ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Cell Biology 2019Quote: HT1080 cells were transfected with Active WNT3A-V5 (G-8) and Active WNT4-V5 (G-10) from Addgene kit #1000000022 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2016) (Fig. 5A, Suppl. Figs. 3C,D and 8; Salk Vector Core; 1.0 x 1012; Addgene plasmid #55636); AAV1-SynP-DIO-splitTVA-EGFP-B19G (Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... were transfected with a complex of 4µg of pAAV2/8 (a gift from James M. Wilson, Addgene #112864), 4µg of pHelper (Takara Bio) ...
-
bioRxiv - Genomics 2021Quote: Plasmid pCBASceI for I-SceI expression and plasmid pcDNA3.1-mCherry were obtained from Addgene (#26477 and #128744 respectively). Guide RNAs TGCGACATAGTAGGGATAAC (gRNA1 ...
-
bioRxiv - Neuroscience 2020Quote: ... mScarlet-i cDNA was amplified by PCR from a pmScarlet-i_C1 plasmid (gift from Dorus Gadella, Addgene #85044) (Bindels et al. ...
-
bioRxiv - Molecular Biology 2023Quote: Lentiviral constructs coding for TLR (#31482) and I-SceI with donor e-GFP (#31476) were purchased from Addgene. To avoid the confounding effect of NHEJ on the repair of I-SceI-induced DNA breaks ...
-
bioRxiv - Neuroscience 2023Quote: ... and 60-120nl AAV2-Ef1a-fDIO-mCherry (2.65×1013 vg/ml, 1.84×1013 vg/ml and 1.1×1013 vg/ml, respectively; Addgene). For monosynaptic retrograde rabies experiments in Foxp2cre+/- mice we injected unilaterally into the MeA 250-500nl of mixed AAV1-CA-Flex-RG and AAV8-Ef1-Flex-TVA-mCherry (1:1 ...
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: One population of U-87 MG cells were transiently transfected with pLV-mitoDsRed (Addgene #44386 ...
-
bioRxiv - Cell Biology 2020Quote: For the generation of stable A549 cell lines expressing various PKCs and mutants we used following plasmids: pcDNA3-PKCε-Flag (wild-type, Addgene, Cambridge, MA), pcDNA3-Flag-K312PKCε ...
-
bioRxiv - Immunology 2019Quote: ... We used the resulting virus particles to transduce immortalized wild-type C57BL/6 cells that express doxycycline-inducible SpCas9 enzyme (generated using Addgene plasmid #50661). We cultured transduced cells in 3.0 μg/ml blasticidin (Invivogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... the wild-type and Δ365-371 mutant CELF1 were cloned in the pET His10 TEV LIC cloning vector (2B-T-10) (Addgene, Cambridge, MA) using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Cell Biology 2021Quote: The Tau/pET29b plasmid used for wild type FLTau (2N4R) expression and purification was a gift from Peter Klein (Addgene plasmid #1631683).
-
bioRxiv - Cell Biology 2019Quote: ... Lztfl1-/- cells (Figure S2) were obtained by genome editing of immortalized wild type MEFs using guide (gMS04: GCTCGATCAAGAAAACCAAC) cloned into pLentiCrisprV2 (Addgene plasmid # 52961) (Sanjana et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... pDsRed-RAB11A WT (for expression of a fluorescently-tagged, wild-type version of RAB11A in human cells) was obtained from Addgene (plasmid 12679). For expression of GFP-HEATR5B from baculovirus ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Optimal magnesium concentration was determined to be 8 mM based on expression of the plasmid pJL1-sfGFP (Addgene #69496) encoding superfolder Green Fluorescent Protein (sfGFP).
-
bioRxiv - Neuroscience 2024Quote: ... and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer, 2.3×1013; Addgene http://addgene.org/114469).
-
bioRxiv - Neuroscience 2024Quote: ... 8 rats were bilaterally injected with DREADDs virus AAV5-CaMKIIα-hM4Di-mCherry (titer, 2.3×1013; Addgene http://addgene.org/50477) and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer ...
-
bioRxiv - Molecular Biology 2021Quote: ... (i) 0.5 μg of AAVS1-TALEN-L and AAVS1-TALEN-R (gift from Dr. Danwei Huangfu, Addgene plasmid # 59025) as well as 2 μg of targeting plasmid were used for nucleofection of hPSC cells ...
-
bioRxiv - Cell Biology 2021Quote: ... mScarlet-i-H2A construct was amplified by PCR from pmScarlet-i_H2A_C1 (a gift from Dorus Gadella, Addgene plasmid #85053) (Bindels et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... U2OS and HEK293 cells were seeded into 10 cm plates 24 h prior to transfection with 2.5 µg of the I-SceI expression vector pCBA-SceI (Addgene plasmid # 26477 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gene encoding Cas3/I-G was cloned into pET Strep II TEV LIC cloning vector (1R, Addgene #29664). All the clones were confirmed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... the full-length dFz2 ORF was amplified and then mScarlet-I was fused to its 3’ end (Addgene #85044). The dFz2-Scarlet fusiomn was then cloned into the UASp vector ...
-
bioRxiv - Cell Biology 2023Quote: The pMTS-mScarlet-I-N1 (mito-mScarlet) was a gift from Dorus Gadella (Addgene plasmid 85059; RRID: Addgene 85059) (Bindels et al. ...
-
bioRxiv - Cell Biology 2023Quote: The pMTS-mScarlet-I-N1 (mito-mScarlet) was a gift from Dorus Gadella (Addgene plasmid 85059; RRID: Addgene 85059) (Bindels et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Venus-iLID-CAAX (from KRas4B) and pLL7.0: tgRFPt-SSPB wild-type (WT) (19) were gifts from Brian Kuhlman (Addgene plasmid #60411 and #60415). PR_GEF (2XPDZ-mCherry-Larg (DH) ...
-
bioRxiv - Bioengineering 2022Quote: Assembloids were formed with VTA- and PFC-like spheroids such that one spheroid type was transduced with AAV9-GCaMP6f (Addgene, cat# 100836-AAV9) while the other was transduced with either an inhibitory or excitatory DREADDs virus (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... were obtained by transducing wild type HCT116 colorectal carcinoma cell line (ATCC® CCL-247™) with lentiCas9-Blast lentiviral vector (Addgene #52962). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... The TFEB wild-type (WT-TFEB [plasmid #38119]) and mutant (Δ30-TFEB [plasmid #44445]) constructs were obtained from Addgene (deposited by Shawn Ferguson) and transfected into H1HeLa using the Lipofectamine 2000 transfection reagent ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... with 20 mg Cas9 (pSpCas9(BB)-2A-Puro (PX459) V2.0 (gift from Feng Zhang; Addgene plasmid #62988 ...
-
bioRxiv - Genetics 2022Quote: ... The plasmid encoding the sgRNA n°8 used in this study is available on Addgene (BPK1520-sgRNA GLB1, Addgene #184378).
-
bioRxiv - Systems Biology 2019Quote: ... the cells were transfected with a mix of 8 µg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library (Addgene #90294) (Hart et al ...
-
bioRxiv - Pathology 2021Quote: ... of adeno-associated virus serotype 8 encoding Cre recombinase under the hepatocyte-specific thyroid binding globulin promoter (AAV8-TBG-Cre) (Addgene) followed by a 12 days (12d ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected using calcium phosphate method with 4-6 µg plasmid DNA and 8 µg of each pMD2.G and psPAX2 (Addgene). After 48 h ...
-
bioRxiv - Systems Biology 2023Quote: ... Lentiviruses were packaged according to the following protocol: Shuttle plasmid (8 μg), psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260 ...