Labshake search
Citations for Addgene :
1 - 50 of 1384 citations for Oligodendrocyte transcription factor 1 OLIG1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The LexA_ER_B112 transcription factor was amplified from Addgene_58437 (FRP880_PACT1(−1-520)-LexA-ER-haB112-TCYC1 was a gift from Joerg Stelling ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L ...
-
bioRxiv - Neuroscience 2024Quote: The transcription factors and the reverse tetracycline transactivator (rtTA) were obtained from Addgene (Tet-O-Fuw-Ascl1 Addgene plasmid #27150 ...
-
bioRxiv - Molecular Biology 2020Quote: ... At least two independent sets of oligonucleotide pairs for gene knockdown of human MTs and the transcription factor MTF-1 (supplementary table S4) were synthesized and cloned into the pLKO.1-TCR vector (Addgene, Cambridge, MA, USA); the same vector was also used as an empty vector control ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Genomics 2020Quote: pNTI729 was constructed by first amplifying the ZEM transcription factor from pNTI638 (pHES795 Addgene #87943) (17 ...
-
bioRxiv - Neuroscience 2021Quote: ... and the Egr1 transcription factor (pcDNA3-Egr1, a gift from Eileen Adamson, Addgene plasmid #11729) known to stimulate the Cav3.2 promotor 25.
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L, ADDGENE/PSIN4-EF2-O2S and ADDGENE/PSIN4-CMV-K2M) ...
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... NPCs were induced into neurons with doxycycline-inducible transcription factor NGN2 with neomycin antibiotic selection (Addgene #99378), following the protocol described by (Ho et al. ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Genes encoding natural transcription factors were sourced from: cJun (pCLXSN-c-JUN, which was a gift from Jin Chen, Addgene plasmid #102758)36 and BATF (pFUW-TetO-BATF ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L, ADDGENE/PSIN4-EF2-O2S and ADDGENE/PSIN4-CMV-K2M). Fibroblast cells were plated in 6-well plates at 1.5 x 105 cells per well (Day 0) ...
-
bioRxiv - Developmental Biology 2022Quote: The three conditional lines for transcription factor overexpression (Rosa-A, GA, GAP) were constructed by modifying the Ai3 targeting construct (Addgene #22797; (Madisen, et al., 2010). The EGFP insert in Ai3 was removed by FseI digestion and replaced with coding regions for the following ...
-
bioRxiv - Bioengineering 2022Quote: ... The T-cell factor/lymphoid enhancer factor (TCF/LEF) luciferase reporter SuperTopFlash (STF) and the control pRL-SV40 Renilla luciferase constructs (Addgene) were used for Wnt/β-catenin-responsive reporter assays ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... Capped Cas9 mRNA was created by in vitro transcription using Thermo Fisher mMESSAGE mMACHINE™ SP6 Transcription Kit from pCS2-nls-zCas9-nls (Addgene#47929)
-
bioRxiv - Cancer Biology 2023Quote: ... transcription activators (lenti MS2-P65- HSF1_Hygro, Addgene plasmid #61426), and single guide RNA (sgRNA ...
-
bioRxiv - Genetics 2021Quote: ... to foster T7 in vitro transcription) for transcription from DR274 (DR274 was a gift from Keith Joung, Addgene plasmid #42250; Hwang et al., 2013).
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Genomics 2020Quote: ... sgRNA was synthesized via in vitro transcription applying plasmid pDD162 (Addgene, Cat # 47549) and HiScribe™ T7 Quick High Yield RNA Synthesis Kit (New England Biolabs ...
-
bioRxiv - Developmental Biology 2021Quote: ... the template for in vitro transcription was digested from pMLM3613 (Addgene catalogue #42251) with PmeI ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cas9 mRNA was generated by linearisation and transcription from the PCS2-nCas9n (Addgene, #47929) clone ...
-
bioRxiv - Synthetic Biology 2019Quote: Plasmids encoding transcription templates were constructed using pUC19-T7-3WJdB-T (Addgene plasmid #87308) as a backbone ...
-
bioRxiv - Neuroscience 2022Quote: ... the complementary DNA (cDNA) for each iMN factor (Ngn2, Lhx3, Isl1, NeuroD1, Ascl1, Brn2 and Myt1l) was purchased from Addgene and cloned into the pMXs retroviral expression vector using Gateway cloning technology (Invitrogen) ...
-
bioRxiv - Developmental Biology 2021Quote: ... CAS9 mRNA was obtained by in vitro transcription of linearised pT3TS-nCas9n vector (Addgene #46757) with MEGAscript T3 kit (Ambion) ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were also generated from in vitro transcription of a modified p2RZ plasmid (Addgene #27664) where RNY4 or RNY4ds3 sequences were cloned between T7 promoter and HDV Ribozyme sequences.
-
bioRxiv - Bioengineering 2022Quote: ... The phiC31 integrase mRNA was prepared by in vitro transcription using EcoRl-linearized plasmid pCDNA3.1_phiC31 (Addgene #68310) or HindIII-linearized plasmid pT7_PhiC31o as the template and mMESSAGE mMACHINE™ T7 Transcription Kit (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: Templates for in vitro transcription of SpCas9 guides were amplified from the plasmid pX330 (Addgene, Watertown, MA) using primer pairs with 65 oligonucleotides as a 5’ primer (forward ...
-
bioRxiv - Developmental Biology 2022Quote: ... The Cas9 mRNA and sgRNA were produced by in vitro transcription from pCS2-nCas9n (Addgene Plasmid #47929) and DraI-digested pDR274 (Addgene Plasmid #42250 ...
-
bioRxiv - Biophysics 2023Quote: ... RNA samples were prepared by in vitro transcription (IVT) using T7 RNA polymerase (Addgene #12413848, prepared in-house). T7 RNA Polymerase ...
-
bioRxiv - Neuroscience 2022Quote: ... the NheI – BsrGI fragment containing SFL in the pcDNA3.1/CAG vector was ligated into the corresponding RE sites of an AAV2 vector with the elongation factor 1α promoter and double-floxed inverted open reading frame (EF1a-DIO; a gift from Karl Deisseroth; Addgene plasmid #: 55631; RRID: Addgene_55631) in the untranslatable reverse orientation ...
-
bioRxiv - Neuroscience 2021Quote: ... The sgRNA to target exon 2 of Ptrpq was generated by in vitro transcription of the target sequence cloned downstream of the T7 promoter in the pX330 vector (Addgene). In vitro transcription was performed using the MAXIscript T7 kit (Life Technologies ...
-
bioRxiv - Genetics 2023Quote: ... following the manufacturer’s protocol with AAVS1 targeting vector and predesigned transcription activator-like effector nucleases (hAAVS1 TALEN Left and Right were gifts from Su-Chun Zhang, Addgene plasmid # 52341 & 52342 ...
-
bioRxiv - Cell Biology 2020Quote: DNA templates used for in vitro transcription of mouse Xist RNA were amplified from sequence verified plasmid pCMV-Xist-PA (Wutz and Jaenisch, 2000) (Addgene 26760), containing the murine Xist gene using high-fidelity Platinum® pfx DNA polymerase (Invitrogen™) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Cas9 mRNA was obtained by in vitro transcription of linearized pT3TS-nCas9n plasmid (a gift from Wenbiao Chen (Addgene plasmid #46757)) using the mMESSAGE mMACHINE T3 kit (Ambion ...
-
bioRxiv - Cancer Biology 2023Quote: ... we replaced the VP64-P65-Rta sequence (encoding transcription activator complex) in the lentiviral vector of dCas9-VPR-mCherry fusion protein (for CRISPRa, Addgene #102245) with the KRAB-MECP2 sequence from the transient expression vector of dCas9-KRAB-MECP2 (for CRISPRi ...
-
bioRxiv - Cell Biology 2019Quote: ... and the sequence follows 5’-atgagtcggtctggcaaccaggtgtcggagtacatctcaaacacatttctcgataagcaacatgaagtggaaatcccctctccaacgcagaaggaaaaagaggaggaggaagagccgatgtcgcagatcagtggggtcaagaagttgatgcacagctccagcctaactaattcatgtatc-3’ Templates for in vitro transcription of the sgRNAs were PCR amplified from the pX335 plasmid (a gift from Feng Zhang, Addgene plasmid # 42335) using the following primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... targeting a sequence upstream of the endogenous NORAD transcription start site or targeting RBMX were cloned into a pU6-sgRNA EF1a-PuroR-T2A-BFP vector (Addgene plasmid #60955). sgRNA sequences are provided in Supplementary File 1 ...
-
bioRxiv - Genetics 2022Quote: ... in vitro transcription assays for human POU6F2 was performed using a reporter plasmid that encodes DsRed under a Hes5 promoter (Addgene, Cat# 26868). For POU6F2 expression vectors ...
-
bioRxiv - Molecular Biology 2023Quote: ... Templates for the in vitro transcription of sgRNAs were generated either by subcloning annealed oligonucleotides containing the target sequences into pDR274 (Addgene, plasmid #42250) via BsaI as described previously (gdf6Y-inactivation ...
-
bioRxiv - Cell Biology 2023Quote: ... dCAS9-KRAB MEL cells were electroporated as above with gRNAs targeting the Myrlin transcription start site cloned into LentiGuide-puro (gift from Feng Zhang, Addgene plasmid #52963). Cells were selected in 10 µg/mL Blasticydin and 1 µg/mL puromycin (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.25 μL of F-ABM lentiviral mix (1:1:1:1 of Addgene plasmids 27150 ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed 1:1 with pAAV.CAMKII.Cre.SV40 (#105558; Addgene), or pAAV.CAG.GFPsm-myc.WPRE.SV40 (#98926 ...
-
bioRxiv - Biochemistry 2024Quote: ... a ∼1:1:1 molar ratio mixture of library transfer (lentiCRISPRv2; Addgene plasmid #52961) and packaging plasmids (psPAX2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Single-chain antibodies fused to GFP (scAB-GFP, Addgene #104998) were used for imaging translation sites through nascent polypeptide labeling ...
-
bioRxiv - Neuroscience 2021Quote: ... DJ-1 (pGEX-5X-1-DJ1-WT; Addgene) or pcDNA plus RFP plasmid(57 ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pRSV-Rev (at a ratio of 4:1:1:1, Addgene#12259, #12251, #12253)41 into HEK293T cells ...
-
bioRxiv - Neuroscience 2019Quote: ... and a 1:1 solution of AAV1.Syn.GCaMP6f.WPRE.SV40 (Addgene) and AAV1.mDlx.GFP-GCaMP6f-Fishell-2.WPRE.SV40 (Penn Vector Core ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pRSFDuet-1 IntS8 AA 1-308 (Addgene #196905), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1 mixture of pENN.AAV.CamKII 0.4.Cre.SV40(AAV1; Addgene #105558 ...