Labshake search
Citations for Addgene :
451 - 500 of 1384 citations for Oligodendrocyte transcription factor 1 OLIG1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... pcDNA3 HA eIF4GI (1–1599) was a gift from Nahum Sonenberg (Addgene plasmid #45640 ...
-
bioRxiv - Genomics 2021Quote: ... The Dlx promoter sequence was from pAAV-mDlx-GFP-Fishell-1 (Addgene plasmid #83900 ...
-
bioRxiv - Cell Biology 2021Quote: ... and a pLKO.1 backbone digested with AgeI/EcoRI (Addgene, cat# 26655), respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... pLVX-IRES-Puro and pLKO.1-Puro plasmids were purchased from Addgene. Lentiviral vector pLKO.1-Puro was used to clone small hairpin RNAs (shRNAs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pLenti-CMV/TO-SV40 small + Large T (w612-1) (#22298, Addgene), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-EF1a-fDIO-mCherry (1 × 1013 vg/ml, 100nl unilateral, #121675, Addgene), AAVrg-EF1a-DIO-FLPo-WPRE-hGHpA (titer 1.6 × 1013 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: Burrhole injections of viral constructs [rAAV2/1&2.hSyn.SIO-eOPN3-mScarlet (Addgene 125713 diluted to 6 × 1012 viral genomes/mL ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hSyn-DIO-NES-jRcamp1b-WPRE-SV40 (Addgene, 4.5E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: ... AAV-hSyn1-SIO-stGtACR2-FusionRed (1×1013 GC/mL, Addgene,105677-AAV1), AAV-synP-DIO-EGFP-WPRE-hGH (0.9×1013 GC/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2/-Syn-ChrimsonR-tdT43 (Addgene plasmid 59171, 1.3×1013 GC ml-1). Dual opsin-assisted circuit mapping and opto-tagging in brain slices ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 ng of Golden Gate recipient vector (pYPQ143; Addgene, USA; Table 1), 0.5 μl BsaI (NEB) ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-CAG-Flex.GCaMP6f.WPRE (3.15×1013 vg/ml, working dilution 1:10, Addgene plasmid #100835-AAV5 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLKO.1 hygro was a gift from Bob Weinberg (Addgene plasmid # 24150) Other vectors generated during this study are available upon request.
-
bioRxiv - Neuroscience 2023Quote: ... Virus (AAV1-S5E2-jGCaMP6f; Addgene #135632-AAV1; diluted 1:3 in saline) was injected into the RSC (AP ...
-
bioRxiv - Neuroscience 2023Quote: ... They then had a 1 μL drop of hSynapsin-dependent Cre (Addgene pENN.AA9V.hSyn.Cre.WPRE.hGH ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were transfected with 1 μg of mCherry- Clathrin LC-15 (Addgene) to label clathrin-coated vesicles ...
-
bioRxiv - Neuroscience 2023Quote: ... a 1 μL dot of AAV9/hSyn/GCaMP6f virus (Addgene, Watertown, MA) diluted 1-5x from commercial titer (2.8x1013 to ∼1x1012 units/mL ...
-
bioRxiv - Immunology 2023Quote: ... eGFP was amplified via PCR from pLJM-1-eGFP (Addgene: Plasmid #19319) using primers that overlapped with pLenti-EF1-Blast at the xho1 site on the 5’ end and overlapped with the 5’-end of the RNase L coding sequence on the 3’-end (Supplementary table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg; Addgene 50861), pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-1:PXN-EGFP (Addgene plasmid #87420; http://n2t.net/addgene:87420; RRID:Addgene_87420), AICSDP-10:LMNB1-mEGFP (Addgene plasmid #87422 ...
-
bioRxiv - Genetics 2023Quote: ... 2.5 μg of DNA (1 μg of mCherry-expressing plasmid (Addgene, 72264), and 1.5 μg of either pcDNA4/TO-eGFP ...
-
bioRxiv - Genomics 2023Quote: ... were each cloned into pLKO.1 puro lentiviral vectors (Addgene cat. #8453). Lentiviral particles containing each of the shRNA constructs were generated by calcium phosphate co-transfection of HEK 293T cells with the shRNA pLKO.1 puro vectors and separate pMDLg/pRRE packaging and pCMV-VSV-G envelope plasmids generously provided by Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific shRNAs were cloned into the pLKO.1 TRC plasmid (Addgene #10878), where the puromycin resistance cassette was replaced by the cDNA coding for DsRed-Express2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific shRNAs were cloned into the pLKO.1 TRC plasmid (Addgene #10878), where the puromycin resistance cassette was replaced by the cDNA coding for DsRed-Express2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of each plasmid pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (Addgene #27078) ...
-
bioRxiv - Cell Biology 2023Quote: ... Annealed oligonucleotides were inserted into the pLKO.1-Hygro vector (#24150, Addgene) digested with AgeI and EcoRI ...
-
bioRxiv - Neuroscience 2023Quote: ... all NLS tagged RFP constructs with p-EGFP-N1 (Addgene; 6085-1). To qualitatively verify Cre-dependent ArgiNLS variant expression ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with pEGFP-C1-Centrin-1 plasmid (Addgene, Plasmid # 72641) using Lipofectamine2000 according to the manufacture’s recommendations ...
-
bioRxiv - Immunology 2024Quote: ... mTagRFP-Membrane-1 was a gift from Michael Davidson (Addgene plasmid # 57992), and we replaced mTagRFP with mApple to construct the mApple-Mem plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... doublefloxed.hChR2(H134R).EYFP.WPRE-HGHpA (diluted 1:2 with dPBS; Addgene number: 20298) was injected into auditory cortex as described above in ChAT-Cre animals ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV-mDlx-GFP-Fishell-1 (a gift from Gordon Fishell, Addgene plasmid # 83900 ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 1 CaMK2a-stGtACR2-FusionRed (1.3 × 1013 gp/mL) (Addgene #105669)83
-
bioRxiv - Cancer Biology 2024Quote: ... shp53 pLKO.1 puro was purchased from Addgene (19119) (shp53 pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 19119 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-Syn-Flex-GCaMP6m-WPRE-SV40 (1×10¹³ vg/ml, Addgene 100838).
-
bioRxiv - Neuroscience 2024Quote: ... The following three viruses were utilized: pAAV.1-CAG-GFP (#37825, Addgene), OE-Npbwr1-GFP ...
-
bioRxiv - Neuroscience 2024Quote: ... The following three viruses were employed: pAAV.1-CAG-GFP (#37825, Addgene), OE-Ttr-GFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... specifically the pLenti PGK Blast V5-LUC (w528-1) plasmid (Addgene #19166). The process involved using SalI-HF (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... or pCAS9- mCherry-Frame +1 plasmid (for conventional CRISPR-Cas9, Addgene #66940), together with 10 μg PiggyBac transposon system (5 μg transposase + 5 μg hygromycin resistance containing transposon)8 were co-electroporated into human duodenum ...
-
bioRxiv - Cancer Biology 2023Quote: ... expressing Tp53 sgRNA (CCTCGAGCTCCCTCTGAGCC) and the pLKO.1-Hygro (Addgene Plasmid #24150) expressing Nf1 sgRNA (GTTGTGCTCGGTGCTGACTT) ...
-
bioRxiv - Cancer Biology 2024Quote: ... S1 Table) were annealed and cloned into the pLKO.1 vector (RRID:Addgene_8453) (29 ...
-
bioRxiv - Biochemistry 2024Quote: ... and pGEX-6P-1-INTS3-FL were gifts from Yuliang Wu (Addgene plasmids #128307 ...
-
bioRxiv - Biophysics 2024Quote: ... The transfer vector consisted of a modified pLKO.1 neo plasmid (Addgene) with expression of the shRNA sequences under control of 3× copies of the lac operator ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1-shCltc1/ shCltc2/ shCltc3 were individually cotransfected with psPAX2 (ADDGENE NO. 12260), pMD2.G (ADDGENE NO ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3.1-GFP(1-10) was a gift from Bo Huang (Addgene plasmid # 70219). 2PH-PLCdelta-GFP was a gift from Sergio Grinstein (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478) and pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453). Lentivirus was generated as described previously (Ferraiuolo et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... High titer (>1012GC/ml) AAV2/1-hSyn-Cre-WPREhGH virus (Addgene 105553-AAV1) was diluted 1:8 or 1:4 in 0.9% saline and 1µl was injected under the forepaw skin ...