Labshake search
Citations for Addgene :
251 - 300 of 335 citations for Mouse Zyxin ZYX ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... 12ug of each pTwist Lenti Puro SFFV WPRE lentiviral construct encoding either human or mouse PRLR were co-transfected with 9ug of psPAX2 (Addgene; 12260) and 3ug of pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers 11 bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, # 139098). Plasmid clones were validated by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... 377 million iCas9-expressing NIH-3T3 cells were transduced with the Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Wang et al, 2017) (Addgene; 1000000096) using spinfection at an MOI of 0.3 to ensure a final library coverage of 500X ...
-
bioRxiv - Cell Biology 2019Quote: ... David Virshup and Xi He (Addgene, Watertown, MA, USA, kit #1000000022) (8) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Volume I was a gift from Richard Murray (Addgene kit #1000000161). pSEVA331Bb was a gift from Tom Ellis (Addgene plasmid # 78269 ...
-
bioRxiv - Cell Biology 2023Quote: ... and the Target Accelerator Pan-Cancer Mutant Collection (Addgene Kit #1000000103)29.
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Physiology 2019Quote: ... Vectors were sourced from OriGene (Rockville, MD) for PISD-expressing plasmid (MR206380), Sigma (St. Louis, MO) for shRNA for mouse PISD (shPSD: TRCN0000115415, and Addgene (Cambridge, MA) for psPAX2 (ID #12260) ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Biochemistry 2020Quote: ... we amplified the open reading frame from a mouse cDNA library using polymerase chain reaction and inserted it into a pBAD His6 Sumo TEV LIC cloning vector (Addgene Plasmid #37507) that had been engineered to encode an N-terminal Avi tag and C-terminal ybbR tag58 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then the coding sequence for mouse KAT2A was amplified from the vector pCMV-sport2-mGCN5 (gift from Sharon Dent, Addgene plasmid # 23098), and cloned into the backbone vector between SpeI and AvrII sites ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... sgRNA validation sgRNAs cut efficiency was assessed in Mouse Embryonic Fibroblasts (MEFs) infected with a lentivirus expressing the Cas9 enzyme along with blasticidin-resistance (Addgene plasmid #52962). 48 hours upon infection ...
-
bioRxiv - Neuroscience 2022Quote: ... ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference (Del Marmol, Touhara et al. 2018) was inserted into MLM3636 vector (Addgene Plasmid #43860). SgRNA inserted MLM3636 and Cas9 expression plasmid pX459 v2.0 (Addgene Plasmid #62988 ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Physiology 2023Quote: ... The latter consisted of the pLV6 backbone and a mouse per2 promoter with adjacent luciferase sequence contained in the pGL3 basic E2 vector (Addgene plasmid 48747). To ligate the Per2:luciferase reporter with pLV6 backbone we designed a restriction cloning approach shown to be efficient in large plasmids using the QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373; http://n2t.net/addgene:127373; RRID: Addgene_127373; kind gift by Lance Miller) to generate pR26-CMV-Opa1 (pAH33) ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2022Quote: Paired mouse genome-scale CRISPR-Cas9 screening libraries (M1/M2) were provided by Shengqing Gu and Xiaole Shirley Liu (Addgene Pooled Library #1000000173). The M1 and M2 libraries cover protein coding genes of the genome with a total of 10 guide RNAs per gene ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cilia-AMSH was generated by fusing the catalytic domain of mouse AMSH (gift from David Komander; Addgene plasmid #66712; (Michel et al., 2015) with NPHP3(1-200 ...
-
bioRxiv - Cell Biology 2023Quote: ... or a modified version of the mouse genome (GRCm38/mm10) containing the mRNA sequence for tdTomato from the ROSA-Ai9 targeting vector (#22799, Addgene, Watertown, MA, USA) to facilitate identification of GLASTAi9 cells in the scRNA-seq datasets.
-
bioRxiv - Neuroscience 2023Quote: ... CRH-IRES-Cre and SOM-IRES-Cre mouse lines were injected with AAV5-EF1a-DIO-EYFP (Addgene 27056, a gift from Karl Deisseroth). In the same mice ...
-
bioRxiv - Molecular Biology 2020Quote: ... The EMMA toolkit was a gift from Yizhi Cai (Addgene kit # 1000000119) [25] ...
-
bioRxiv - Neuroscience 2019Quote: ... using the Golden Gate TALEN and TAL Effector Kit 2.0 (Addgene 1000000024). TALEN mRNAs were synthesized by in vitro transcription using the mMessage mMachine SP6 Kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... The EMMA toolkit was a gift from Yizhi Cai (Addgene kit # 1000000119). Various parts from the toolkit were used for construction of the vectors ...
-
bioRxiv - Molecular Biology 2023Quote: ... David Virshup and Xi He from the plasmid kit73 (Addgene kit # 1000000022). HALO*EBP-HA and HALO*EBP constructs were originated from a pBSM13-Pax7HALO plasmid that was designed in our lab ...
-
bioRxiv - Molecular Biology 2023Quote: ... Yeast Toolkit plasmids were a gift from John Dueber (Addgene kit # 1000000061). pAJ4619 was made from pAJ4618 by inverse PCR using oligos AJO3551 and AJO3539 ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for GFP-tagged two FYVE domains of mouse HRS and PH domain of human TAPP1 were obtained from Addgene (#140047 and #161985, respectively) and cloned into the pLVX-IRES-puro vector ...
-
bioRxiv - Systems Biology 2021Quote: ... individual drivers were PCR amplified out of the Cancer Pathways kit (Addgene #1000000072)21 ...
-
bioRxiv - Biochemistry 2021Quote: ... The RAS clone collection was a gift from Dominic Esposito (Addgene kit 1000000070). GST tagged RAF1-RBD (GST-RAF-RBD ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we performed two-step cloning using a Platinum Gate TALEN kit (Addgene, #1000000043). In the assembly-step 1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The ENO1 terminator fragment was amplified from pYTK051 (Addgene Kit #1000000061 position E3) (Lee et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... KIT D816V ESCs were generated as described previously using the pX335 vector (Addgene 42335) and oligonucleotides listed in supplemental Table 3.29
-
bioRxiv - Cancer Biology 2022Quote: ... Luciferase/tdTomatao reporter was engineered using the MuLE system kit from Addgene (Cat. # 1000000060) (54).
-
bioRxiv - Systems Biology 2021Quote: Inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tet-on inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The BGA polyadenylation signal was amplified from plasmid C7 (MXS Chaining Kit; Addgene reference #62424)[15] and the Ef1A promoter was amplified from plasmid C4 (MXS Chaining Kit ...
-
bioRxiv - Synthetic Biology 2019Quote: ... synthetic gene fragments from Integrated DNA Technologies (IDT) and the EcoFlex kit (47) from Addgene.
-
bioRxiv - Synthetic Biology 2021Quote: All remaining plasmids were generated using Goldengate cloning with the MoClo toolkit (Addgene Kit#1000000044) as described in Weber et al ...
-
bioRxiv - Neuroscience 2021Quote: Human DRD1 and DRD2 in pcDNA vectors were achieved using the PRESTO-Tango kit (Addgene). To generate R-DRD1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Gβ and Gγ-GFP2 constructs were purchased as part of the TRUPATH kit from Addgene.
-
bioRxiv - Molecular Biology 2023Quote: ... cerevisiae Advanced Gateway™ Destination Vectors were a gift from Susan Lindquist (Addgene kit #1000000011).
-
bioRxiv - Neuroscience 2023Quote: ... TALE repeat arrays were assembled using the Joung Lab REAL Assembly TALEN kit (Addgene 1000000017). Synthesized TALEN mRNAs were injected into the cytoplasm of one-cell stage embryos ...
-
bioRxiv - Systems Biology 2024Quote: ... Gβ3 and Gγ9-GFP2 were purchased as part of the TRUPATH biosensor kit from Addgene. The oligonucleotides for making the GαsE392K-Rluc8 and GαsL388R-Rluc8 mutations were designed using Agilent Technologies’ online primer design tool ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and terminator parts used in the constructs described were provided by Douglas Densmore (Addgene kit 1000000059).
-
bioRxiv - Biophysics 2020Quote: We assembled TALE-TF with the Golden Gate TALEN and TAL Effector Kit2.0 (Addgene kit #1000000024) 101 as previously described 23 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Addgene reference #62424)[15] and the Ef1A promoter was amplified from plasmid C4 (MXS Chaining Kit; Addgene reference #62421).
-
bioRxiv - Biochemistry 2022Quote: ... The Saccharomyces cerevisiae Advanced Gateway Destination Vector Kit was purchased from Addgene (Watertown, MA, United States). Phusion high-fidelity DNA polymerase (New England Biolabs ...