Labshake search
Citations for Addgene :
1 - 50 of 335 citations for Mouse Zyxin ZYX ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319 ...
-
bioRxiv - Cell Biology 2022Quote: mEmerald-Zyxin-C-14 construct (Addgene # 54318; a gift from Michael Davidson) was cloned into the lentiviral vector pLL5.0 (Vitriol et al. ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319; http://n2t.net/addgene:54319; RRID: Addgene_54319) and mCherry-Paxillin-22 (Addgene plasmid # 55114 ...
-
bioRxiv - Cell Biology 2022Quote: ... and the gRNAs for Zyxin or Scrambled were cloned into pTLCV2 (Addgene # 87360; a gift from Adam Karpf).
-
bioRxiv - Biophysics 2022Quote: ... kindly provided by Ewa Paluch lab, UCL), RFP-zyxin (kindly provided by Anna Huttenlocher lab, University of Wisconsin-Madison) or mCherry-MRLC2A (Addgene). For experiments with inhibitors ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Genomics 2020Quote: The CRISPR/Cas9 plasmid (CTCF-mouse-3sgRNA-CRISPRexp-AID) was assembled using the Multiplex CRISPR/Cas9 Assembly System kit57 (a gift from Takashi Yamamoto, Addgene kit #1000000055). Oligonucleotides for three gRNA templates were synthesized ...
-
bioRxiv - Neuroscience 2021Quote: ... or KH1*KH2* mutants were PCR amplified from their respective pAc5.1B-EGFP vector and cloned into the HindIII and EcoRI sites of the pAc5.1-lambdaN-HA vector (a gift from Elisa Izaurralde; Addgene plasmid #21302) (Behm-Ansmant et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... was PCR amplified and cloned downstream of EGFP in the pAc5.1B-EGFP vector (a gift from Elisa Izaurralde; Addgene plasmid #21181) using the HindIII and EcoRI restriction sites to make pAcB5.1-EGFP-FMRP ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The YTK kit (Addgene; Kit #1000000061) was used as a source for all relevant non-coding DNA sequences — including promoters and terminators ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MoClo Plant Parts Kit (Addgene Kit #1000000047), GreenGate Cloning System (Addgene Kit #1000000036 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Cell Biology 2021Quote: The pcDNA 3.1 (-) mouse C/EBPδ expression vector (AddGene, #12559) and annealed oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Biophysics 2023Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Systems Biology 2022Quote: ... and lambda phosphatase were purchased from Addgene (Addgene Kit #1000000094)7.