Labshake search
Citations for Addgene :
201 - 250 of 1289 citations for Mouse WD repeat containing protein WRAP73 WRAP73 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA-containing plentiCRISPRv2 plasmids were co-transfected with psPAX2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were first infected with lentivirus containing lentiCas9-Blast plasmid (Addgene, # 52962) using similar spinfection protocol described above ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pUS252b (containing fuGFPb) was a gift from Nicholas Coleman (Addgene plasmid #191831). pJL1-eforRed ...
-
bioRxiv - Cell Biology 2023Quote: A plasmid containing the cDNA encoding TurboID was purchased from Addgene (107169). The pCAG-V5-TurboID vector was constructed by inserting the amplified TurboID cDNA containing the V5 epitope (GKPIPNPLLGLDST ...
-
bioRxiv - Genomics 2024Quote: ... we used a SaCas9 and GFP-containing backbone (Addgene #118836, plasmid pTRI211) into which was cloned the SaCas9-CTG sgRNA to give plasmid pTRI 212.
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmids containing the CAST system were derived from pSL1142 (Addgene plasmid #160730).33 All experiments were performed in wild-type (WT ...
-
bioRxiv - Cancer Biology 2024Quote: peGFP-C1 vectors containing full-length Rab27B (GFP-Rab27B, Addgene plasmid #89447) and mutant forms of Rab27B that encoded constitutively active Q78L (GFP-Rab27B Q78L ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The YTK kit (Addgene; Kit #1000000061) was used as a source for all relevant non-coding DNA sequences — including promoters and terminators ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999) (Voigt et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NLS-stdMCP-stdHalo fusion protein (Addgene plasmid: 104999) (Voigt et al. ...
-
bioRxiv - Biophysics 2021Quote: ... The tandem PCP (tdPCP) protein was derived from Addgene plasmid #40650 ...
-
bioRxiv - Microbiology 2022Quote: ... individual proteins were cloned into vector 2-BT (Addgene #29666 ...
-
bioRxiv - Physiology 2022Quote: ... or tdTomato-EB3 fusion protein (Addgene, EB3-tdTomato, #50708) was performed as 5 repeated measurements × 5 cells × 3 independent experiments ...
-
bioRxiv - Biophysics 2021Quote: The plasmid containing yeast (Saccharomyces cerevisiae) Ubr1 was purchased from Addgene (plasmid # 24506) 41 ...
-
bioRxiv - Genomics 2019Quote: The expression vector containing the PA-Tnp fusion construct is available from Addgene under accession number 121137 ...
-
bioRxiv - Developmental Biology 2019Quote: The lentiCRISPRv2-mCherry plasmid containing cas9 and Cherry fragments was purchased from Addgene (#99154 ...
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected with either TOP flash (containing TCF binding sites; Addgene#12456) or FOP flash (mutated TCF binding sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the gene of interest containing pLJM1 lentiviral packaging plasmids (Addgene, catalog #91980) at concentrations of 1.3 pmol ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biochemistry 2021Quote: ... was inserted into a vector PX601-containing wild-type SaCas9 (Addgene plasmid #61591) and replacing that domain of SaCas9 ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 μg of CS2-plasmid containing the ORF for Cas9 (Addgene #51307) or H2B-RFP was linearized by Not1 endonuclease digestion ...
-
bioRxiv - Genetics 2019Quote: ... The plasmid containing Enhanced SpCas9 (version 1.1, Addgene #71814, Slaymaker et al., 2016) was a generous gift of Carine Giovannangeli from the Museum National d’Histoire Naturelle ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The fragment containing the LbCpf1 coding sequence was amplified from pY016 hLbCpf1 (Addgene plasmid # 69988 ...
-
bioRxiv - Biochemistry 2020Quote: We used the human SREBP-1c cDNA containing vector pQCXIN (Addgene, USA, 631514) as a template to generate 2x Flag tagged ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids containing coding regions for the FPs mKate (mKate-H4-23, Addgene 56061), mRUBY (GCaMP6f-mRUBY ...
-
bioRxiv - Immunology 2020Quote: ... a vector containing human IgG3 was purchased from Addgene (pVITRO1-102.1F10-IgG3/λ) and then cloned into a vector for recombinant IgG expression that we previously engineered [59].
-
bioRxiv - Neuroscience 2021Quote: ... and donor DNA plasmid containing a neomycin-resistance cassette (adapted from Addgene, PL552). Transfected cells were selected with neomycin for one week ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 cells were transduced with lentivirus containing lentiCas9-Blast construct (Addgene #52962) and selected with growth medium containing 4 µg/ml blasticidin for approximately one week ...
-
bioRxiv - Neuroscience 2022Quote: The AAV-2 ITR containing plasmids pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (Addgene plasmid #104495 ...
-
bioRxiv - Neuroscience 2023Quote: ... and the sgRNA plasmid along with a plasmid containing Cas9 (pLX_311-Cas9, Addgene) were transfected into iPSCs using Lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2022Quote: ... The plasmid containing gRNA targeting AAVSI locus was obtained from Addgene (plasmid #41818). hiPS cells (2 × 106 cells ...
-
bioRxiv - Biophysics 2023Quote: DNA was synthesized from a Widom 601 sequence containing plasmid pGEMz_601 (Addgene, 26656) with primers containing a biotin and Cy3 ...
-
bioRxiv - Bioengineering 2023Quote: ... AAV9 vectors containing CMV-driven Cre plasmids were obtained from Addgene (pENN.AAV.CMVs.Pl.Cre.rBG #105537). Vectors were stored in a solution containing PBS and 0.001% Pluronic F-68.
-
bioRxiv - Molecular Biology 2023Quote: ... containing the AAVS1-T2 targeting guide and pSH-EFIRES-P-AtAFB2 (#129715, Addgene), which was digested using BglII [#R0144 ...
-
bioRxiv - Bioengineering 2023Quote: ... a plasmid containing the human codon-optimized Cas12a gene was obtained from Addgene, then was PCR amplified using Q5 Hot Start high fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: A lentiviral plasmid containing a dCAS9/KRAB/MeCP2 cassette was obtained from Addgene. Lenti-X 293T cells were transfected using this plasmid and virus containing the plasmid was generated and appropriate titers were determined ...
-
bioRxiv - Genetics 2023Quote: We used the 3XFLAG-VP64-SadCas9-NLS-VP64-containing plasmid (Addgene cat # 135338), in which each sgRNA was annealed and inserted by BsaI directional cloning as described previously31 ...