Labshake search
Citations for Addgene :
1 - 50 of 1289 citations for Mouse WD repeat containing protein WRAP73 WRAP73 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Cell Biology 2023Quote: ... A fragment containing 24xGCN4_v4 repeats was derived from Addgene plasmid #74928 ...
-
bioRxiv - Molecular Biology 2023Quote: ... CAST I-B system’s proteins and inverted repeat constructs were sub-cloned from Addgene plasmids #168137 and #168146 to generate pIF1003.
-
bioRxiv - Genetics 2022Quote: ... 24X MS2 repeats (Addgene #31865) were cloned into a vector containing homology arms at the first predicted high-efficiency cut site after the stop codon for the keratin-10 locus (26bp after stop ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat sequences (PguCas13b: Addgene 103853 ...
-
bioRxiv - Neuroscience 2023Quote: ... TALE repeat arrays were assembled using the Joung Lab REAL Assembly TALEN kit (Addgene 1000000017). Synthesized TALEN mRNAs were injected into the cytoplasm of one-cell stage embryos ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat (DR) sequences (PguCas13b: Addgene 103853 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and inverted repeats were sub-cloned from Addgene plasmids #130637 ...
-
bioRxiv - Cell Biology 2019Quote: Plasmids for the FRET-based aggregation reporter were constructed by cloning a fusion of the K18 repeat domain of tau containing the P301L/V337M mutation (20) in frame with C-terminal Clover2 (Addgene #54711) or mRuby2 (Addgene #54768 ...
-
bioRxiv - Bioengineering 2023Quote: ... crRNA expression plasmids for the Type I Eco Cascade system were generated by annealing synthetic DNA ultramers (IDT) containing direct repeats (DRs) and cloning these ultramers into the BbsI and SacI-digested SpCas9 sgRNA cloning plasmid (Addgene #47108) using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Genomics 2019Quote: ... which contained the p-Element inverted repeats (Addgene, #15308). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... A fragment with 24xMS2v7 repeats was obtained from Addgene plasmid #140705 and cloned downstream of the coding sequence ...
-
bioRxiv - Biochemistry 2024Quote: ... or 74 CAG repeats (GFP-Q74: mutant HTT. Addgene, #40262). Vectors to alpha synuclein were a gift from our collaborator Dr ...
-
bioRxiv - Molecular Biology 2023Quote: ... CAST V and inverted repeat constructs were sub-cloned from Addgene plasmids #127922 and #127924 to generate pIF1005 ...
-
bioRxiv - Bioengineering 2020Quote: ... pMD2.G containing VSV-G envelop protein (Addgene, #12259) and pCMVΔR8.2 (Addgene ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat sequences (PguCas13b: Addgene 103853, PspCas13b: Addgene 103854, RfxCas13d: Addgene 109053) as described above ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat sequences (PguCas13b: Addgene 103853, PspCas13b: Addgene 103854, RfxCas13d: Addgene 109053) as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... TALEN repeat variable di-residues (RVDs) were cloned into an RCIscript-GoldyTALEN vector (Addgene) and capped mRNAs for each TALENs were in vitro transcribed from SacI-linearized expression plasmids using mMESSAGE mMACHINE T3 kit (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids encoding HA-tagged LRR (leucine-rich-repeat) domains of LRRFIP2 (Addgene plasmid # 21152), and Fli1 (Addgene plasmid # 21151) ...
-
bioRxiv - Molecular Biology 2023Quote: ... allowing for ligation into BsmBI digested plasmid that encodes RfxCas13d direct repeat (Addgene #138150). PspCas13b crRNA spacers were designed as 34-nt single-stranded forward and reverse oligos containing CACC and CAAC overhangs ...
-
bioRxiv - Molecular Biology 2023Quote: ... allowing for ligation into Bbsl-digested plasmid that encodes PspCas13b direct repeat (Addgene #103854). Oligos were ordered as single stranded DNA (IDT ...
-
bioRxiv - Immunology 2020Quote: Plasmids containing fluorescent protein coding sequences mCerulean3-N1 (Addgene # 54730), mAzurite-N1 (Addgene # 54617) ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat (DR) sequences (PguCas13b: Addgene 103853, PspCas13b: Addgene 103854, RfxCas13d: Addgene 109053) into lentiCRISPRv2 ...
-
bioRxiv - Genomics 2019Quote: ... and their direct repeat (DR) sequences (PguCas13b: Addgene 103853, PspCas13b: Addgene 103854, RfxCas13d: Addgene 109053) into lentiCRISPRv2 ...
-
bioRxiv - Neuroscience 2022Quote: ... and a PCR amplicon containing the CRISPRoff-v2.1 protein from Addgene plasmid 167981 (gifted from Luke Gilbert [45] ...
-
bioRxiv - Neuroscience 2022Quote: ... and a plasmid containing the Rep/Cap proteins (Addgene Plasmid #112862) using polyethylenimine (Polysciences) ...
-
bioRxiv - Biochemistry 2020Quote: The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) system with pX330 vector (Addgene) was used to edit the CDC50A gene in HEK293S GnT1-cells as described 4 ...
-
bioRxiv - Microbiology 2024Quote: The human CRISPR (clustered regularly interspaced short palindromic repeats) “Brunello” lentiviral pooled library was purchased from Addgene. The library version in the lentiCRISPRv2 backbone was chosen ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... we cloned the DNA encoding the TALE repeats and flanking regions into JDS74 (plasmid #32288) and JDS71 (plasmid #32287) vectors (Addgene). The vector OCT4-2A-eGFP-PKG-Puro (plasmid #31938 ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2022Quote: ... pXR003 processed gRNA was cloned into pKLV2.3-Hygro mCherry gRNA lentiviral plasmid (33) using EcoRI and Mlu and amplying (d)CasRx directed repeats from pXR003 processed gRNA (Addgene #109053) using the following F (CCCACGCGTGAGGGCCTATTTCCCATGATTC ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing a C-terminus EGFP-tagged sequence of the full-length M237I p53 protein (Addgene, #11770), and 4 µL of Lipofectamine 2000 reagent ...
-
bioRxiv - Biophysics 2020Quote: The plasmid containing 1.6 kb telomeric TTAGGG repeats with a 23-bp interruption linking two (TTAGGG) 135 regions (T270, 5.4 kb) was purchased from Addgene (plasmid pSXneo(T2AG3), #12403 ...
-
bioRxiv - Developmental Biology 2022Quote: ... a solution containing two sgRNAs (40 ng/μL each) and Cas9 protein (250 ng/μL) (Addgene; 47327) (Gagnon et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... fragments containing promoter and fusion protein segments were digested and cloned into the pKHR4 vector (Addgene #74592) using SpeI (NEB #R3133 ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Cell Biology 2024Quote: ... For G3BP1 live imaging a GFP-G3BP1 fusion protein containing plasmid (pEGFP-C1-G3BP1-WT, Addgene plasmid # 135997) was transfected with Lipofectamine™ 3000 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a plasmid containing cloned wild type AlkB protein (pET24a-AlkB deltaN11 [plasmid #73622]) was obtained from Addgene (http://www.addgene.org/), and the AlkB protein was expressed and purified at the CSU Biochemistry and Molecular Biology Protein Expression and Purification Facility.
-
bioRxiv - Molecular Biology 2023Quote: More than 140 million wild type Abl pre-B cells carrying inducible Cas9 transgene were transduced with a lentiviral gRNA library containing 90,230 gRNAs targeting over 18,000 mouse genes (Addgene, 67988) by spin-infection as described above ...
-
bioRxiv - Biophysics 2024Quote: ... pET3a aSyn murine plasmid containing a gene encoding mouse α-synuclein was a gift from Gabriele Kaminski Schierle (Addgene plasmid # 108865 ...
-
bioRxiv - Cell Biology 2019Quote: ... pET-3d plasmid containing Chicken Capping Protein α1 and β1 subunits was a gift from John Cooper (Addgene plasmid #13451) The N-terminal domain of mouse CAP1 in pSUMOck4 was described earlier66.
-
bioRxiv - Evolutionary Biology 2020Quote: ... five nanoliters of a solution containing both sgRNAs at a concentration of 40 ng/μL and Cas9 protein (Addgene #47327) at a concentration of 250 ng/μL32 was injected into one-cell-stage medaka embryos ...
-
bioRxiv - Biochemistry 2022Quote: The pET28a plasmid vector containing DNA sequences encoding the PANK3 protein (residues pro12 to Asn368) was purchased from Addgene (25518) and transformed into both E ...
-
bioRxiv - Biochemistry 2022Quote: ... All expression constructs were in the form containing an N-terminal His6 and maltose-binding protein (MBP) tag (Addgene #11517).
-
bioRxiv - Biochemistry 2023Quote: ... 2 µg of pX330 plasmid containing sgRNA for the target protein and 0.2 µg of pcDNA3-FKBP-eGFP-HOTag3 (Addgene, #106924) were co-transfected using Lipofectamine 2000 (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were infected at low viral titer with the pooled mouse CRISPR lentiviral library containing 78,637 gRNAs targeting 19,674 genes (Addgene #73633-LV). Infected cells were selected with puromycin (1 μg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...