Labshake search
Citations for Addgene :
201 - 250 of 2039 citations for Mouse WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... The ecDHFR degron domain was amplified from CAG-DDdCas9VP192-T2A-EGFP-ires-puro (Addgene plasmid # 69534; http://n2t.net/addgene:69534; RRID:Addgene_69534, a gift from Timo Otonkoski). The SMASh degron domain was amplified from pCS6-SMASh-YFP ...
-
bioRxiv - Plant Biology 2022Quote: ... while the full-length coding sequence of HlMYB7 was cloned into the prey vector pGADT7-GW [DNA-binding domain (BD)] (Addgene Inc, MA, USA) using the In-Fusion Snap Assembly Kit (Takara Bio) ...
-
bioRxiv - Cell Biology 2023Quote: ... or a modified version of the mouse genome (GRCm38/mm10) containing the mRNA sequence for tdTomato from the ROSA-Ai9 targeting vector (#22799, Addgene, Watertown, MA, USA) to facilitate identification of GLASTAi9 cells in the scRNA-seq datasets.
-
bioRxiv - Microbiology 2021Quote: ... A plasmid encoding stabilized SARS-CoV-2 spike protein S-HexaPro (Hsieh et al., 2020) was a gift from Jason McLellan (Addgene plasmid #154754 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cells were co-transfected using Lipofectamine 3000 and 15μg of DNA encoding for viral protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Biophysics 2023Quote: ... and 15 µg of the plasmid encoding the respective viral surface protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Immunology 2019Quote: ... The PresentER plasmid encoding a signal peptide from Mouse Mammary Tumor Virus envelope protein followed by the SIINFEKL epitope followed by mCherry was obtained from Addgene (#102945),a kind gift of D ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) with 8xHis tag was obtained from Addgene (#145145). The mammalian expression vector for soluble ACE2 pcDNA3-sACE2 (WT)-sfGFP (#145171 ...
-
bioRxiv - Neuroscience 2023Quote: ... The construct encoding SARS-CoV-2 matrix (M) protein was cloned by PCR amplification of M cDNA from the pDONR 207 SARS-CoV-2 M plasmid (Addgene #141274) using a Forward primer inserting a restriction site for EcoRI and a reverse primer bearing a restriction site for BamHI and a Myc tag ...
-
bioRxiv - Microbiology 2023Quote: ... and pRN-Luc (50 ng) reporter plasmids in combination with S protein expressing plasmids pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Cell Biology 2021Quote: ... .The KIF1C motor domain was replaced with full length human KIF1C fused to mCherry from pKIF1C-mCherry (available from Addgene 130978 (Theisen et al., 2012)) using NheI and BsrGI ...
-
bioRxiv - Plant Biology 2024Quote: ... together with a fragment containing the nucleotides encoding for the Pip1 pro-domain but lacking the signal peptide (pJK110; Supplemental Table S4) were combined in all 64 possible combinations with pICH41264 (Addgene #4799; Weber et al., 2011) in a BpiI Golden Gate reaction (Supplemental Table S4) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids containing sgRNAs (Addgene 41824) and a human codon-optimized Cas9 (Addgene 41815 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plasmids containing EYA2 (Addgene #49264), RUNX1T1 (Addgene #49264) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Immunology 2023Quote: ... coli containing the pMF230 plasmid containing a constitutively active promoter and eGFP were ordered from Addgene and cultivated on 100 uM ampicillin LB agar plates ...
-
bioRxiv - Developmental Biology 2020Quote: ... and MiniP containing pEMS1172 (Addgene, #29301), pEMS1375 (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: - 22.1ug sgRNA containing pXPR_053 (Addgene 113591).
-
bioRxiv - Molecular Biology 2021Quote: Lentivirus containing dCas9-TET1 (#84475, Addgene) or dCas9-dTET1 (#84479 ...
-
bioRxiv - Microbiology 2023Quote: ... Electrocompetent cells containing pREDCas9 (Addgene #71541) were generated as previously described[68] ...
-
bioRxiv - Genomics 2023Quote: ... containing either miRFP670 (Addgene plasmid #163748) or tagBFP (Addgene plasmid #163747 ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Biochemistry 2021Quote: A 20 μL reaction containing 150 ng of a plasmid containing two loxP sites (Addgene Plasmid #26852) and 500 nM of Cre or Cre mutants in recombination buffer (50 mM Tris-Cl ...
-
bioRxiv - Neuroscience 2023Quote: ... LR reaction was performed using R83B04 containing entry vector and lexA containing (pBPLexA::p65Uw) destination vector (Addgene: 26231). Transgenic fly generation was conducted by GenetiVision ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Microbiology 2020Quote: ... A plasmid containing the ACE2 gene (Addgene) was digested with Nhe I and Kpn I and the fragment was ligated into the similarly digested pLenti-III-HA vector plasmid ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids containing sirtuins were ordered from Addgene, and all of them were produced by Eric Verdin ...
-
bioRxiv - Molecular Biology 2021Quote: ... a vector containing 24xMS2v6 (Addgene Plasmid #104391) was double-digested and the MS2 cassette was gel purified ...
-
bioRxiv - Immunology 2021Quote: ... along with the DHFR containing vector (Addgene) to produce 2H1-mIgG3-CH1a-1 ...
-
bioRxiv - Genomics 2021Quote: ... gene fragment containing CTT pegRNA (Addgene #132778) was PCR amplified using primer sets adding 5-bp degenerate barcode and flanking BsmBI site for the downstream cloning steps ...
-
bioRxiv - Cancer Biology 2022Quote: Plasmids containing AcGFP and LbNOX (Addgene #75285) were gifts from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Plant Biology 2019Quote: ... the resulting gRNA plasmids were then recombined with a L1 construct containing pYAO:Cas9_3:E9t39 (kindly provided by Jonathan Jones) and a L1 construct containing Fast-Red selection marker (AddGene #117499) into a L2 binary vector (AddGene #112207).
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated with Protein A/G-MNase fusion protein (Addgene, Cat #123461) at 700 ng/mL for 1 hour at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Biophysics 2020Quote: ... Dual transfections containing mCh-Drp1 (Addgene, plasmid #49152) and Mito-GFP (gift from Hari Shroff ...
-
bioRxiv - Systems Biology 2021Quote: ... Sleeping Beauty transposase containing pSB100 vector (Addgene #34879) was a kindly gift of Dr ...
-
bioRxiv - Neuroscience 2020Quote: ... The AAV vector containing floxed ChR2 (Addgene #20297) and floxed eNpHR (Addgene #26966 ...