Labshake search
Citations for Addgene :
151 - 200 of 2039 citations for Mouse WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: We in-house generated a lentiviral construct expressing dCas9-KRAB-MeCP2 by PCR amplification of the dCas9-KRAB-MeCP2 (contains a domain of MeCP2) from pB-CAGGS-dCas9-KRAB-MeCP2 (Addgene 110824), and then insert it to the pLenti-EF1a-dCas9-VP64-2A-Blast backbone (Addgene 61425 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The CMV-OsTIR1-PURO plasmid was digested with AfeI and we inserted the codon optimized ARF16-PB1 domain separated by P2A from Os-TIR1 to generate the ARF16-PB1-HA-P2A-OsTIR1 construct (pMGS46, Addgene #126580). This plasmid was co-transfected with AAVS1 sgRNA (pMGS7 ...
-
bioRxiv - Cancer Biology 2019Quote: ... in the leucine zipper region of the bZIP domain by site-directed mutagenesis of the pBabe mRFP1-NRF2 hygro plasmid (Addgene #136579) originally prepared by subcloning into pBabe mRFP1 hygro ...
-
bioRxiv - Cell Biology 2020Quote: ... The recombinant WNK1 kinase domain was eluted via addition of 50 nM bdSENDP1 protease (Frey et al., 2014; Addgene ID 104962) in wash buffer 4.
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The catalytically active domains of JARID1A enzyme (1-797 amino acids) was amplified from pcDNA3/HA-FLAG-RBP2 plasmid (Addgene #14800), a gift from William Kaelin (Klose et al ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Cell Biology 2022Quote: To generate an additional inducible KNL1Mut-dCas9 expression vector (in addition to pIND20) the FKBP12 degradation domain (DD, Banaszynski 2006) was first amplified from Degron-KI-donor backbone (Addgene #65483) and inserted at the N-terminus of the fusion protein sequence in pENTR-KNL1-dCas9 using Gibson cloning ...
-
bioRxiv - Cell Biology 2019Quote: ... Human N-WASP GBD domain was PCR amplified from pCS2-mRFP-GBD (a kind gift from William Bement, Addgene plasmid 26733) with XhoI/AscI flanking restriction sites and cloned into pET-pmKate2 to generate mKate-GBD ...
-
bioRxiv - Biochemistry 2019Quote: ... sapiens Pyk2 kinase domain expression vector PTK2BA encoding H6-TEV-kinase [414-692] was a gift from Nicola Burgess-Brown (Addgene # 42401). Cloning vector pET-H6-SUMO-TEV-LIC (1S ...
-
bioRxiv - Cell Biology 2019Quote: SUMO-amphSH3 and GST-amphSH3 were generated by subcloning murine Ampiphysin1 SH3 domain residues 607-686) from pAmph1-mCherry (kind gift from C. Merrifield, Addgene 27692) using BamHI and XhoI restriction sites into a modified pET-SUMO bacterial expression vector (Life Technologies ...
-
bioRxiv - Genetics 2019Quote: ... coli AraC (residues 175-281, provided by Gregory Bowman), the SpyCatcher domain (Zakeri et al., 2012) (a gift from Mark Howarth, Addgene 35044) and dCas9 (subcloned from Addgene 49013 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cytosolic domain of Miro1 (Miro1(ΔTM)) and the iLID binding peptide (SspB, obtained from Addgene #60415, gift from B. Kuhlman) were fused into pmCherry-C1 using EcoRI and KpnI ...
-
bioRxiv - Neuroscience 2021Quote: ... targeting LRRK2 sequence near GTP binding and ATP kinase binding domains were synthesized and cloned into pSpCas9(BB)-2A-GFP plasmid (Addgene #48138). Plasmids were transfected into A18945 iPSC line using Lipofectamine-Stem transfection reagent (ThermoFisher #STEM00001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and ΔC (251-545 aa) truncation domains were PCR amplified and cloned into pET Strep II TEV LIC cloning vector (1R, Addgene #29664). The genes encoding Csb1/I-G ...
-
bioRxiv - Plant Biology 2023Quote: ... and MOM1 CMM2 domain (aa1660-aa1860)5 were first cloned into gateway entry vectors followed by LR reaction with pGBKT7-GW (Addgene 61703) and pGADT7-GW (Addgene 61702 ...
-
bioRxiv - Microbiology 2022Quote: The SARS CoV-2 papain-like protease (PLpro) domain of Nsp3 was cloned from a doxycycline-inducible piggyBac transposon vector (PB-TAC-ERP2, Addgene# 80478) containing the synthesized full-length Nsp3 from the Wuhan-Hu-1 SARS CoV 2 strain (Alvarez and Yao ...
-
bioRxiv - Cell Biology 2023Quote: ... The oDi sequence encoding a coiled-coil dimerization domain was amplified by PCR (#503/#504) from SpyCatcher002-oDi (a gift from Mark Howarth, Addgene # 124661) (Khairil Anuar et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... the oTet sequence encoding a tetramerization coiled-coil domain was obtained by PCR (#505/#506) from SpyCatcher002-oTet (a gift from Mark Howarth, Addgene # 124663) (Khairil Anuar et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned CreERT2 (Cre recombinase fused to a mutant ligand-binding domain of the estrogen receptor) and IRES into the BamHI site of pAAV-EF1a-tdTomato-WPRE-pGHpA (Addgene #67527). To prevent leakage of Cre activity34 ...
-
bioRxiv - Cell Biology 2022Quote: The S1R-Apex construct was generated by cloning a gene synthesized product containing the cDNA sequence for mouse S1R into the pCDNA3_Sec61B-V5-APEX2 vector (Addgene plasmid 83411) (67) ...
-
bioRxiv - Immunology 2020Quote: ... pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Molecular Biology 2021Quote: FUS-ΔIDR-SHARP was generated by recombining the ΔIDR-SHARP entry clone into a modified version of the PB-HALO-IRES-NGFR vector containing the IDR sequence from the FUS protein tagged with mCherry (Addgene plasmid 101223) in place of HALO ...
-
bioRxiv - Physiology 2023Quote: ... containing endothelial specific-promoter (CDH5, VE-Cadherin) and green fluorescent protein (GFP) and the plasmid pC4-RhE-FRB-Fis1 (Addgene Cat# 68056) containing human Fis1 gene were purchased from Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Biochemistry 2023Quote: The pET28-eGFP-SLAP was digested with BamHI and XhoI restriction enzymes and the SLAPTAG-containing band was subcloned into SARS-CoV-2 S HexaPro plasmid (Addgene#154754) with the same restriction sites.
-
bioRxiv - Cancer Biology 2023Quote: HEK293 cells were transfected with a mixture of the 3rd generation lentiviral packaging plasmids containing: 2 μg of Rev (pRSV-Rev, Addgene #12253), 2 μg of Gag and Pol (pMDLg/pRRE ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2024Quote: ... that was first PCR amplified using custom primers (see Table 2) from a plasmid containing lexAop2 (lexAop2-myr-4xSNAPf, RRID: Addgene 87638) and then restriction digested using HindIII and PspXI (New England BioLabs ...
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Cell Biology 2020Quote: Human SH3 domain nucleotides (hLynSH3, amino acids 63-123) were amplified by PCR and cloned into a mammalian expression vector pEBG (Addgene, plasmid # 22227) with an N-terminal glutathione S-transferase (GST ...
-
bioRxiv - Neuroscience 2022Quote: ... Err2EnR was generated by fusing the open reading frame of the transcriptional repressor domain of Drosophila Engrailed (amplified from CAG-EnR plasmid, Addgene plasmid #19715, Addgene, Watertown, USA) to Err2.
-
bioRxiv - Genomics 2021Quote: Human codon-optimized optimized Streptococcus pyogenes dCas9 with two C-terminal SV40 NLSs was fused at the N-terminus to the ABI domain (gift from Jerry Crabtree, Addgene plasmid #38247) and tagBFP ...
-
bioRxiv - Biochemistry 2020Quote: ... coli RP hk339-GFP (monomeric His-tagged Kif5B kinesin motor domain) expression plasmid was a gift from Ron Vale (Addgene plasmid #24431).
-
bioRxiv - Molecular Biology 2022Quote: ... the ACE2 and its ECT/PD domains were cloned into pBiFC-VN155 (I152L) and pBiFC-VC155 vector(Kodama and Hu, 2010) (Addgene, MA, USA). The RBD ...
-
bioRxiv - Cell Biology 2022Quote: ... expressing myristoylated FGFR1 cytoplasmic region fused with the PHR domain of cryptochrome2 and mCitrine (gift from Won Do Heo (Addgene plasmid # 59776), (Kim et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Chimeras of the minimal domain (NTD) ORF24 homologs with ORF24 202-752 were generated using two-insert InFusion cloning (Addgene #138453-138455) into BamHI/XhoI-cut pcDNA4/TO-2xStrep (C-terminal tag).
-
bioRxiv - Pathology 2019Quote: ... antisense: CGAGTTCATGACGGCGCGCA) targeting the DID domain region of INF2 was expressed using a lentiviral plasmid (Cat. no:5296, lentiCRISPRV2, Addgene, Boston, MA). All cloned plasmids were confirmed for the correct sequence by DNA sequencing (Genewiz ...
-
bioRxiv - Synthetic Biology 2019Quote: ... AcrIIC3-LOV2 hybrid constructs were created by inserting the LOV2 domain into our published CMV-driven AcrIIC3 expression vector (Addgene plasmid #120301) (51) ...
-
bioRxiv - Cell Biology 2023Quote: ... The KT binding domain sequence of 53BP1 (aa 1235-1616) was PCR-amplified from pcDNA5-FRT/TO-eGFP-53BP1 (Addgene plasmid #60813) and cloned into pB66 downstream to the Gal4 DNA-binding domain ...
-
bioRxiv - Biochemistry 2023Quote: ... and the 6xHis-SUMO tag was removed by enzymatic cleavage using human Sentrin-specific protease 1 (SENP1) catalytic domain (derived from pET28a-HsSENP1, that was a gift from Jorge Eduardo Azevedo (Addgene plasmid #71465) at 4°C overnight27,28 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Full-length Sema6a cDNA or shortened Sema6a lacking the sequence coding for the intracellular domain (bp 2680-3766) were cloned into the pCAG-GFP vector (Addgene, Cat #11150) to obtain pCAG-promotor-driven expression of Sema6a and Sema6aΔcyt with a GFP signal sequence located upstream.
-
bioRxiv - Evolutionary Biology 2024Quote: ... we first replaced the SH3 domain with a flexible linker (GGSSGGGG) using yeast competent cells that were co-transformed with a pCAS plasmid (Addgene plasmid 60847) expressing both the gRNA of interest and Streptococcus pyogenes Cas9 and a donor DNA sequence (stuffer ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...