Labshake search
Citations for Addgene :
551 - 593 of 593 citations for Mouse IgG1 Isotype Control Antibody 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... The PresentER plasmid encoding a signal peptide from Mouse Mammary Tumor Virus envelope protein followed by the SIINFEKL epitope followed by mCherry was obtained from Addgene (#102945),a kind gift of D ...
-
bioRxiv - Developmental Biology 2020Quote: ... Constitutive active form of mouse ChREBP was subcloned into pMSCVhyg-3xT7 to generate pMSCVhyg-3xT7-CA-ChREBP using full length clone as templates (Addgene #39235). All plasmids were confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2021Quote: ... The Cherry Brie pooled CRISPR library was obtained by Gibson assembly cloning to place the sgRNA sequences form the Mouse Brie CRISPR knockout pooled library (a gift from David Root and John Doench (Addgene #73633)) into the LentiGuide-Cherry plasmid (Supplementary Figure 1A) ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression construct for mouse MLXIPL was generated by PCR-amplification from a template plasmid (from the laboratory of Isabelle Leclerc, Addgene #39235) and cloned into pcDNA3 with an N-terminal FLAG epitope tag by Gibson assembly ...
-
bioRxiv - Molecular Biology 2023Quote: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The reference was generated from the mouse genome (GRCm38) and annotation (GRCm38.93) and modified to include the sequences for tdTomato (Addgene plasmid # 22799) (Madisen et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... guide RNA targeting the first exon of the mouse NHE1 gene was designed and cloned into an all-in-one doxycycline (Dox)-inducible vector TLCV2 (Addgene #87360). In brief ...
-
bioRxiv - Microbiology 2022Quote: The mouse Brie pooled sgRNA library on the lentiGuide-Puro backbone was obtained from David Root and John Doench (Addgene #73633) (23) ...
-
bioRxiv - Genetics 2023Quote: The gRNA library used for the screening was the Mouse Improved Genome-wide Knockout CRISPR Library v2 (a gift from Kosuke Yusa, Addgene, #67988) (48) ...
-
bioRxiv - Developmental Biology 2023Quote: ... pCAGEN-Ntn4 expression plasmid was constructed by cloning the full-length coding sequence out of mouse Ntn4-AP-His plasmid (Addgene 71980) using the primers in Table 1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: Full-length human GLI3 and mouse Gli3 cDNAs were obtained from pEGFPC3-hGli3 (a gift from Aimin Liu, Addgene plasmid, (57)) and pCMV-Gli3-Myc-DDK (ORIGENE ...
-
bioRxiv - Developmental Biology 2023Quote: Single guide RNAs (sgRNAs) targeting each of the specific target genes were retrieved from the Mouse CRISPR Knockout Pooled Library (Addgene #73632). Two sgRNA sequences were selected per gene of interest (for sgRNAs sequences ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers 11 bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, # 139098). Plasmid clones were validated by Sanger sequencing ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 12ug of each pTwist Lenti Puro SFFV WPRE lentiviral construct encoding either human or mouse PRLR were co-transfected with 9ug of psPAX2 (Addgene; 12260) and 3ug of pMD2.G (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... of Fbxo24 and Skp1 were cloned and amplified using cDNA obtained from mouse testis and inserted into the multiple cloning site of pCAG1.1 vector (Addgene; Plasmid #173685). To generate the expression vector coding Fbxo24(ΔF-box) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 377 million iCas9-expressing NIH-3T3 cells were transduced with the Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Wang et al, 2017) (Addgene; 1000000096) using spinfection at an MOI of 0.3 to ensure a final library coverage of 500X ...
-
bioRxiv - Genomics 2020Quote: The CRISPR/Cas9 plasmid (CTCF-mouse-3sgRNA-CRISPRexp-AID) was assembled using the Multiplex CRISPR/Cas9 Assembly System kit57 (a gift from Takashi Yamamoto, Addgene kit #1000000055). Oligonucleotides for three gRNA templates were synthesized ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Physiology 2019Quote: ... Vectors were sourced from OriGene (Rockville, MD) for PISD-expressing plasmid (MR206380), Sigma (St. Louis, MO) for shRNA for mouse PISD (shPSD: TRCN0000115415, and Addgene (Cambridge, MA) for psPAX2 (ID #12260) ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Biochemistry 2020Quote: ... we amplified the open reading frame from a mouse cDNA library using polymerase chain reaction and inserted it into a pBAD His6 Sumo TEV LIC cloning vector (Addgene Plasmid #37507) that had been engineered to encode an N-terminal Avi tag and C-terminal ybbR tag58 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then the coding sequence for mouse KAT2A was amplified from the vector pCMV-sport2-mGCN5 (gift from Sharon Dent, Addgene plasmid # 23098), and cloned into the backbone vector between SpeI and AvrII sites ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... sgRNA validation sgRNAs cut efficiency was assessed in Mouse Embryonic Fibroblasts (MEFs) infected with a lentivirus expressing the Cas9 enzyme along with blasticidin-resistance (Addgene plasmid #52962). 48 hours upon infection ...
-
bioRxiv - Neuroscience 2022Quote: ... ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference (Del Marmol, Touhara et al. 2018) was inserted into MLM3636 vector (Addgene Plasmid #43860). SgRNA inserted MLM3636 and Cas9 expression plasmid pX459 v2.0 (Addgene Plasmid #62988 ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373; http://n2t.net/addgene:127373; RRID: Addgene_127373; kind gift by Lance Miller) to generate pR26-CMV-Opa1 (pAH33) ...
-
bioRxiv - Physiology 2023Quote: ... The latter consisted of the pLV6 backbone and a mouse per2 promoter with adjacent luciferase sequence contained in the pGL3 basic E2 vector (Addgene plasmid 48747). To ligate the Per2:luciferase reporter with pLV6 backbone we designed a restriction cloning approach shown to be efficient in large plasmids using the QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2022Quote: Paired mouse genome-scale CRISPR-Cas9 screening libraries (M1/M2) were provided by Shengqing Gu and Xiaole Shirley Liu (Addgene Pooled Library #1000000173). The M1 and M2 libraries cover protein coding genes of the genome with a total of 10 guide RNAs per gene ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cilia-AMSH was generated by fusing the catalytic domain of mouse AMSH (gift from David Komander; Addgene plasmid #66712; (Michel et al., 2015) with NPHP3(1-200 ...
-
bioRxiv - Cell Biology 2023Quote: ... or a modified version of the mouse genome (GRCm38/mm10) containing the mRNA sequence for tdTomato from the ROSA-Ai9 targeting vector (#22799, Addgene, Watertown, MA, USA) to facilitate identification of GLASTAi9 cells in the scRNA-seq datasets.
-
bioRxiv - Neuroscience 2023Quote: ... CRH-IRES-Cre and SOM-IRES-Cre mouse lines were injected with AAV5-EF1a-DIO-EYFP (Addgene 27056, a gift from Karl Deisseroth). In the same mice ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for GFP-tagged two FYVE domains of mouse HRS and PH domain of human TAPP1 were obtained from Addgene (#140047 and #161985, respectively) and cloned into the pLVX-IRES-puro vector ...
-
bioRxiv - Systems Biology 2021Quote: Inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tet-on inducible mouse CCN4 expression lentiviral vector (IDmCCN4) was constructed with Gateway cloning using Tet-on destination lentiviral vector pCW57.1 (Addgene Plasmid #41393, a gift from David Root) and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303 ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Bioengineering 2020Quote: ... Heavy and light chain DNA sequences of antibody fragments (Fab) were purchased from Twist Bioscience and cloned separately into the pHLsec mammalian expression vector (Addgene, #99845) via Gibson assembly ...
-
bioRxiv - Microbiology 2021Quote: ... the antibody component of the SunTag system (pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS45, a gift from Ron Vale, Addgene #60904) was digested with EcoRI+NotI and subcloned into the blunted BamHi site of pCW-TRE ...
-
bioRxiv - Cell Biology 2020Quote: The ATF4-SunTag reporter was stably integrated into a previously-described HeLa-11ht cell line stably expressing GFP-tagged single-chain antibodies (scFvGFP) against GCN4 (Addgene plasmid #104998) and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999 ...
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...