Labshake search
Citations for Addgene :
251 - 300 of 593 citations for Mouse IgG1 Isotype Control Antibody 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... Noxa and a negative control non-targeting protospacer were individually cloned into BstXI/BlpI-digested pCRISPRia-v2 (Addgene #8432) by ligating annealed complementary synthetic oligonucleotide pairs ...
-
bioRxiv - Genetics 2019Quote: A self-complementary rAAV vector expressing GFP under control of a CAG promoter (pscAAV-CAG-GFP, Addgene, Cat#83279) was generated by replacing the CMV promoter in plasmid pscAAV-GFP (gift from John T Gray ...
-
bioRxiv - Biophysics 2021Quote: Monomeric and multimeric fluorescent controls were derived by modifying previously published plasmids designed to express CD86-EGFP (Addgene # 133858) and mApple-CD86-EGFP (Addgene #133860 ...
-
bioRxiv - Systems Biology 2021Quote: ... additional control plasmids (PA-NL, Addgene #113445; PA-mCit-NL, Addgene #113444; PA-mCit, Addgene #113443; NL, Addgene #113442) were used ...
-
bioRxiv - Systems Biology 2021Quote: ... additional control plasmids (PA-NL, Addgene #113445; PA-mCit-NL, Addgene #113444; PA-mCit, Addgene #113443; NL, Addgene #113442) were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... all the sgRNAs targeting genes of interest as well as controls were cloned into LRG2.1 (derived from U6-sgRNA-GFP, Addgene: 108098 - as described in ref (Tarumoto et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... PTEN or non-targeting-control (see Table 3) were cloned into pLKV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene ID:67974) and Cas9 expressing cell lines were transduced and selected with puromycin (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice that were cre-positive received the AAV-hM3D injection (test mice) or a control virus AAV-YFP (Addgene) (control mice ...
-
bioRxiv - Molecular Biology 2022Quote: ... Addgene plasmid # 12456) and 5 ng of Renilla luciferase control plasmid (a gift from David Bartel; Addgene plasmid # 12179) in each well ...
-
bioRxiv - Neuroscience 2022Quote: ... 200nl of adeno-associated virus 2 (AAV2) containing either control construct (pAAV-hSyn-EGFP; plasmid #50465; Addgene, Watertown, MA) or excitatory DREADD (pAAV-hSyn-hM3D(Gq)-mCherry ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected either rAAV2/9 encoding GCaMP6s (Chen et al., 2013) under control of the CaMKII promoter (1.25 × 1013 gc/ml; AddGene viral prep #107790-AAV9 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a non-human control were amplified from the pSB700 plasmid and cloned into PB-TRE-dCas9_VPR (Addgene #63800) using the following primers ...
-
bioRxiv - Genetics 2020Quote: ... We generated cell lines expressing KRAB-dCas9-IRES-BFP under the control of a doxycycline-inducible promoter (Addgene #85449) and the reverse tetracycline transactivator (rtTA ...
-
bioRxiv - Molecular Biology 2023Quote: Drosophila reporter plasmids expressing eGFP under the control of the inducible Metallothionein A promoter (Hy_pMT eGFP SV40; Addgene #69911), Hml promoter (Hy_pHml eGFP SV40 ...
-
bioRxiv - Neuroscience 2022Quote: ... or rAAV2/9 encoding for NIR-GECO2 under control of the synthetic CAG promoter (0.5 × 1012 -1 × 1013 gc/ml; AddGene plasmid #159603 ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected either rAAV2/10 encoding ChrimsonR(K176R) and the red fluorophore tdTomato under control of the human synapsin promoter (1.13 × 1013 gc/ml; AddGene plasmid #59171 ...
-
bioRxiv - Neuroscience 2022Quote: ... and the cyan fluorophore mCerulean under control of the human synapsin promoter (1.5 × 1012 gc/ml; customized from AddGene plasmid #59171 ...
-
bioRxiv - Neuroscience 2022Quote: ... Control groups were injected with pAAV-hSyn-mCherry (a gift from Karl Deisseroth; Addgene viral prep # 114472-AAV5; Addgene viral prep # 114472-AAVrg ...
-
bioRxiv - Molecular Biology 2023Quote: ... were described previously.27,54 Reporter plasmids expressing eGFP under the control of the RnrS promoter (Hy_pRnrS eGFP SV40, Addgene #195062) or Ana promoter (Hy_pAna eGFP SV40 ...
-
bioRxiv - Neuroscience 2023Quote: ... A control vector lacking the hM4Di receptor was also used (AAV8-CaMKII-EGFP; 2.1 x 1013 gc/ml Addgene viral prep # 50469-AAV8 ...
-
bioRxiv - Systems Biology 2023Quote: ... additional control plasmids (PA-NL, Addgene #113445; PA-mCit-NL, Addgene #113444; PA-mCit, Addgene #113443; NL, Addgene #113442) were used ...
-
bioRxiv - Systems Biology 2023Quote: ... additional control plasmids (PA-NL, Addgene #113445; PA-mCit-NL, Addgene #113444; PA-mCit, Addgene #113443; NL, Addgene #113442) were used ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All plasmids that express GFPuv under the control of a phoB promoter were obtained from Addgene (supplemental table 1) 43,46 ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK 293T cells were transfected with either sulfatase 1 or sulfatase 2 expression plasmids or empty vector control derived from pcDNA3.1 (RRID: Addgene_79663) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice for optogenetic experiments were injected with AAV5-EF1a-DIO-EYFP (Addgene 27056, a gift from Karl Deisseroth). For Cre-dependent expression of excitatory DREADDs ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2024Quote: ... Either 375nl AAV9-CAG-FLEX-tdTomato (wheel running and optogenetic control, Addgene 28306-AAV9, 3.8 x 1013 gc/mL) or AAV9-CAG-Flex-ChR2-tdTomato (optogenetic stimulation ...
-
bioRxiv - Neuroscience 2024Quote: ... and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer, 2.3×1013; Addgene http://addgene.org/114469).
-
bioRxiv - Molecular Biology 2021Quote: ... Gfp dsRNA was used as a control for all experiments and was generated from the vector pOPINEneo-3C-GFP (Addgene plasmid # 53534 ...
-
bioRxiv - Neuroscience 2019Quote: ... or the shRNA control (dsRed2) AGTTCCAGTACGGCTCCAA or (GFP) CAAGCTGACCCTGAAGTTC were first cloned separately into a pSicoR vector (Addgene, Ref. 11579) under the control of a U6 promoter using HpaI and BstEII enzymes then ...
-
bioRxiv - Biochemistry 2019Quote: A plasmid expressing GST-Neh2Dual in bacteria under control of the T7 promoter was constructed by replacing vOTU from pOPINK-vOTU (Addgene plasmid # 61589 ...
-
bioRxiv - Bioengineering 2021Quote: AAV transduction of the genetically encoded GCaMP6s calcium reporter and mRuby control tag (AAV1-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA, AddGene) was performed at DIV1 as previously described50 ...
-
Peripheral CB1 receptor blockade acts as a memory enhancer through an adrenergic-dependent mechanismbioRxiv - Neuroscience 2021Quote: We used the following vectors: AAV-hM4Di-DREADD (AAV5-hSyn-hM4D(Gi)-mCherry) and AAV-control-DREADD (AAV5-hSyn-mCherry) from Addgene.
-
bioRxiv - Biochemistry 2020Quote: The plasmid encoding WT-α-syn was cloned into a pAAV vector under the control of a CMV promoter (Addgene plasmid #36055 ...
-
bioRxiv - Cell Biology 2021Quote: ... and the other containing the firefly luciferase gene under the control of the Pomc promoter (−646bp to +65bp) (#17553, Addgene). Forty-eight hours after transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... except that an additional lentivirus expressing eGFP under the control of a TET-responsive promoter was included (Addgene Cat # 30130). eGFP-positive neurons were mixed with eGFP-negative neurons in the 96-well plates ...
-
bioRxiv - Neuroscience 2022Quote: ... opsin construct), >1.3×1013 vector genomes/ml (Neuroscience Center Zurich, control construct) and 1.4 × 1013 GC/mL (Addgene, opsin construct). The viral vectors were aliquoted and stored at -80°C until stereotaxic injection surgeries.
-
bioRxiv - Cancer Biology 2022Quote: We cloned shRNAs against SCD and GPX4 as well as control shRNA in the Tet-pLKO-puro vector (Gift from Dmitri Wiederschain, Addgene plasmid #21915 ...
-
bioRxiv - Cell Biology 2022Quote: ... or pHAGE plasmids for overexpression of SOX15 or control mCherry were cotransfected with packaging vectors (psPAX2 and pMD2.G; Addgene) into 293T cells using PEI methods ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Neuroscience 2020Quote: ... Human His-tagged SETD1A expression pET28-SETD1A-MHL plasmid and its control pET28-MHL were gifts from Cheryl Arrowsmith (Addgene plasmid # 32868 and #26096 ...
-
bioRxiv - Neuroscience 2019Quote: ... The shRNA constructs to knockdown human DNMT3A1/3A2 and scrambled controls were hDNMT3A shRNA pSMP-DNMT3A1 and pSMP-Luc (a gift from George Daley, Addgene plasmid #36380, Addgene plasmid #36394 ...
-
bioRxiv - Neuroscience 2019Quote: ... The shRNA constructs to knockdown human DNMT3A1/3A2 and scrambled controls were hDNMT3A shRNA pSMP-DNMT3A1 and pSMP-Luc (a gift from George Daley, Addgene plasmid #36380 ...
-
bioRxiv - Genomics 2019Quote: Melanoma cells and melanocyte growth assays were conducted using lentiviral transduction of MX2 cDNA under the control of tetracycline-inducible promoter using pINDUCER20 vector (Addgene). The MX2 cDNA clone (RC206437 ...
-
bioRxiv - Microbiology 2021Quote: ... Packaging 293T cells were transfected with targeted gene sgRNAs or negative control (non-targeting sgRNA-NC) and helper vectors (pMD2.G and psPAX2; gifts from Didier Trono; Addgene plasmid #s 12259 and 12260 ...
-
bioRxiv - Genomics 2021Quote: ... one set of cells received a lentivirus expressing the Cre recombinase under the control of the hSyn1 promoter (Addgene 86641). This induced expression of the dCas9p300 transgene in the neurons ...
-
bioRxiv - Molecular Biology 2021Quote: The knockdown plasmids for REST/NRSF and for the control GFP were constructed by ligating annealed primer pairs into the pLKO.1 vector (Addgene) between the EcoRI and AgeI sites ...
-
bioRxiv - Neuroscience 2021Quote: ... we used a commercially available AAV vector encoding the Ca2+ indicator GCaMP6s under the control of the CaMKIIa promoter (Addgene #107790 ...
-
bioRxiv - Bioengineering 2022Quote: ... The T-cell factor/lymphoid enhancer factor (TCF/LEF) luciferase reporter SuperTopFlash (STF) and the control pRL-SV40 Renilla luciferase constructs (Addgene) were used for Wnt/β-catenin-responsive reporter assays ...