Labshake search
Citations for Addgene :
51 - 100 of 2173 citations for Mac 1 SAP mouse human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... RBM41 C-terminal fragment (259–413) and full-length 65K were cloned into MAC-tag-N vector (Addgene #108078, a gift from Markku Varjosalo) using Gateway cloning as described (Liu et al. ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome CRISPR Screening was performed using the Human CRISPR Knockout Pooled Library (Brunello) - 1 vector system (Addgene and a gift from John Doench to the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus)(44) ...
-
bioRxiv - Neuroscience 2023Quote: The following expression constructs were used: human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574 ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression plasmids for WT and catalytic mutant mouse Lipin-1 were obtained from Addgene. Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: Human FL-RING1A (1–406aa) and CSD HP1β(80–185aa) were subcloned into bacterial expression 1GFP vector (Addgene #29663) and 1B vector (Addgene #29653) ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Systems Biology 2021Quote: ... human knockout CRISPR v1 library (Addgene #67989) (39) ...
-
bioRxiv - Microbiology 2021Quote: The human CRISPR Brunello library (Addgene 73178) (16 ...
-
bioRxiv - Neuroscience 2022Quote: ... including the human IgG1 Fc (Addgene #145165), and mouse IgG1 Fc (Addgene #28216 ...
-
bioRxiv - Cell Biology 2023Quote: ... from human pcDNA3.1-2xFLAG-SREBP1a (#26801, Addgene), pcDNA3.1-2xFLAG-SREBP1c (#26802 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Sin1.1 was PCR-amplified from Addgene 73388 plasmid (gift from Taekjip Ha32 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Microbiology 2024Quote: ... The human RAB6Q72L was subcloned from Addgene plasmid #49483 into a bacteria expression pGEX-4T-1 vector encoding a N-terminal GST tag followed by a TEV cleavage site.
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Cell Biology 2021Quote: ... The constitutively active form of kinesin-1 (human KIF5B, K560) was cloned by PCR from pet17-K560-GFP_His (Addgene, 15219) into pEGFP-N1 vector using EcoRI primer (104-5p EcoRI-K560 ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... we designed single guide RNAs to target the exon 1 of the human Per2 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Per2 plasmid ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Cell Biology 2022Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... encoding human KDM6A with HA tag and pCS2-UTX-F-MT2 (40619) encoding enzyme-dead human KDM6A were purchased from Addgene. The HR and NHEJ reporter plasmids were kind gifts from Tomasz Skorski (61) ...
-
bioRxiv - Cancer Biology 2021Quote: The human MYC cDNA was purchased from Addgene (pDONR223_MYC_WT ...
-
bioRxiv - Molecular Biology 2019Quote: ... and a human codon-optimized Cas9 (Addgene 41815) were co-nucleofected into target cells by nucleofection (Lonza apparatus) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human ETV1 (Addgene, Cambridge, MA, USA; plasmid #82209) and ETV5 (Horizon Discovery ...
-
bioRxiv - Biochemistry 2020Quote: Plasmids encoding human full-length WDR5 (2GNQ, Addgene) or a 20aa N-terminal truncation (ΔN20 ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Addgene # 1000000049) and lenti-Cas9 plasmid were obtained from addgene (Addgene # 52962) ...
-
bioRxiv - Neuroscience 2021Quote: Heterologous expression of human NaV1.2 WT (Addgene #162279)(DeKeyser et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... human TERT (LOX-TERT-iresTK; Addgene plasmid #12245), generously provided by Didier Trono ...
-
bioRxiv - Neuroscience 2022Quote: ... Human VAC14 was obtained from Addgene (Plasmid #47418) and subcloned into the mCherry- C1 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) was cloned in pET15b with N-terminal 6xHis and C-terminal StrepII tags ...
-
bioRxiv - Microbiology 2023Quote: The human SAM CRISPRa sgRNA library (Addgene #1000000078) was cloned into the pHW-TRPPC-NS rescue plasmid backbone for PR8 (Fig S2A ...
-
bioRxiv - Biophysics 2023Quote: Human MeCP2 in the pTXB1 plasmid (Addgene #48091) was propagated in E ...
-
bioRxiv - Immunology 2023Quote: A lentiviral construct containing human ACE2 (Addgene 155295) or mScarlet (Addgene 85044 ...
-
bioRxiv - Physiology 2023Quote: ... containing human Fis1 gene were purchased from Addgene. The working viral vectors were constructed from these two plasmids by Custom DNA Constructs ...
-
bioRxiv - Biochemistry 2023Quote: Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) and human dynamin2 C-terminally tagged to mCherry were cloned in pET15b with an N-terminal 6xHis and a C-terminal StrepII tag ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse H2A.Z.1 gene in pIND-EGFP was a kind gift from from Danny Rangasamy (Addgene plasmid # 15770 ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Genetics 2020Quote: sgRNA sequences targeting human USP15 were selected from the Human Brunello CRISPR knockout pooled library (Doench et al., 2016)(Addgene #73178) and further selected on the basis of high quality score in two additional online tools ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified human KEAP1 and LKB1 off of human cDNA and used Gibson assembly to replace GFP in pMCB306 (Addgene #89360) with these sequences ...