Labshake search
Citations for Addgene :
301 - 350 of 2173 citations for Mac 1 SAP mouse human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: Plasmid mutagenesis was performed on pKS070 - pCAGGS-3XFLAG-(human) CTCF-eGFP (Addgene Plasmid #156448) for CTCF and mEmerald-RAD21-N-18 (Addgene Plasmid #54248 ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: The Human Brunello library was a gift from David Root and John Doench18 (Addgene #73178). The Toronto human knockout pooled library (TKO ...
-
bioRxiv - Developmental Biology 2021Quote: ... confluent human embryonic kidney (HEK293T) cells were co-transfected with pWPXL (Addgene, Cambridge, MA, USA), and a mixture of packaging helper plasmids (psPAX ...
-
bioRxiv - Developmental Biology 2020Quote: The histone acetyltransferase domain from human p300 was subcloned from a published construct (Addgene, 61357) (Hilton et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... Wild-type human CDH1 on a pcDNA3 plasmid was obtained (hE-cadherin-pcDNA3, Addgene, 45769). Variants were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2019Quote: ... which were made by amplifying human Rab1a or Rab5c (Rab1a: Addgene: #46776, Rab5c: GeneArt synthesis) by PCR and inserting the genes in pEGFP-C1 via SacI-KpnI ...
-
bioRxiv - Neuroscience 2019Quote: ... the human TSC1 gene was PCR amplified from a vector containing the hTSC1 cDNA (Addgene) 70 ...
-
bioRxiv - Immunology 2021Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 µL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting SARS-CoV-2 pps ...
-
bioRxiv - Bioengineering 2020Quote: ... Full-length human ACE2 was a kind gift from Hyeryun Choe 22 (Addgene plasmid #1786).
-
bioRxiv - Immunology 2021Quote: The full human GeCKOv2 CRISPR knockout pooled library (Addgene #1000000048, a gift from Feng Zhang) was used for genome-wide screening40 ...
-
bioRxiv - Cell Biology 2021Quote: The Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat (Addgene #90294). The library was amplified in bacteria as described in the Moffat protocol on Addgene (https://www.addgene.org/pooled-library/moffat-crispr-knockout-tkov3/) ...
-
bioRxiv - Cell Biology 2021Quote: ... NPC1 human fibroblasts were transfected with either eGFP-Vector or eGFP-HSP70 (Addgene, Cat#15215) plasmid using an Amaxa human dermal fibroblast kit and manufacturer recommended U2OS protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... human MCU gRNA3 (hMCU gRNA1) was subcloned into the lentiCRISPR v2 backbone (Addgene, Plasmid #52961) and transfected into wild-type HEK293 cells via nucleofection as previously described ...
-
bioRxiv - Cancer Biology 2021Quote: GeCKO v2 human library made by Zhangfeng’s lab was purchased from Addgene (Watertown, MA, USA) amplified as described(Joung et al. ...
-
bioRxiv - Microbiology 2021Quote: Human furin was cloned in the sleeping beauty transposon plasmid26 pSB-bi-RP (Addgene #60513), transfected along with transposase ...
-
Sequence and structural variations determining the recruitment of WNK kinases to the KLHL3 E3 ligasebioRxiv - Molecular Biology 2020Quote: ... human KLHL3 (a.a. 298–587) was cloned into the pNIC28-Bsa4 vector (Addgene plasmid #110251), which provides an N-terminal hexahistidine tag as previously described [9] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Smad3 overexpression plasmid was constructed by subcloning human Smad3 cDNA into pcDNA3.0 backbone plasmid (Addgene). GAS5 adenoviral vector was constructed by inserting mouse GAS5 cDNA into pShuttle-IRES-hrGFP-1 vector (Agilent) ...
-
bioRxiv - Genetics 2021Quote: ... The TERT-immortalized human melanocyte cell C283T was infected with pCW-Cas9-Blast from Addgene followed by introduction of lentiGuide-Puro (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: U2OS cells harboring Doxycycline-inducible human RNF168 were generated using the pINDUCER20 lentiviral vector (Addgene plasmid # 44012 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reference sgRNA sequences for human GeCKO v2.0 (A and B) were downloaded from Addgene (https://www.addgene.org/pooled-library/) ...
-
bioRxiv - Immunology 2020Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 µL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting of SARS-CoV-2 pps ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Plasmids for the expression of myc-tagged human ACE2 (pCEP4-myc-ACE2, Addgene No. 141185), 8his-tagged monomeric sACE2 (ACE2 a.a ...
-
bioRxiv - Neuroscience 2021Quote: Human DRD1 and DRD2 in pcDNA vectors were achieved using the PRESTO-Tango kit (Addgene). To generate R-DRD1 ...
-
bioRxiv - Immunology 2020Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 μL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting SARS-CoV-2 pps ...
-
bioRxiv - Neuroscience 2021Quote: ... the human Synapsin (hSyn) promoter in pAAV-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, cat #: 50459) was replaced with mouse CaMKIIa promoter using MluI and SalI restriction sites to produce pAAV-CaMKII-DIO-hM4D(Gi)-mCherry and pAAV-CaMKII-DIO-mCherry ...
-
bioRxiv - Molecular Biology 2022Quote: The human metabolic knockout pooled CRISPR library was a gift from David Sabatini (Addgene # 110066). For lentivirus production ...
-
bioRxiv - Cell Biology 2022Quote: Full-length ERK3 wild type (WT) pDONR-223 construct purified from Human Kinase Library (Addgene) was used as a template to generate ERK3 K49A K50A kinase dead (KD ...
-
bioRxiv - Microbiology 2023Quote: ... GFP or human c-MET cDNA were PCR amplified from plasmid pLenti-MetGFP (Addgene #37560) and seamlessly cloned into the BamHI/XbaI sites of vector pLenti-spCas9-Blast (Addgene #52962) ...
-
bioRxiv - Biophysics 2023Quote: Human BAF57 and BAF155 gene fragments were amplified from plasmids pBS-hBAF57 (Addgene ID #17877) and pBS-hBAF155 (Addgene ID #17876) ...
-
bioRxiv - Neuroscience 2023Quote: Human iPSCs were edited using the pSpCas9(BB)-2A-GFP (PX458) construct backbone (Addgene #48138) described in Ran et al 201380 ...
-
bioRxiv - Cell Biology 2023Quote: Coding sequence of human PITX2C (NM_000325.6) was cloned into lentivirus transfer plasmid (pWPI, Addgene#12254) using Gibson Assembly® kit (NEB ...
-
bioRxiv - Systems Biology 2022Quote: ... 240 million cells were transduced with lentivirus from the Human Genome-wide CRISPRi-v2 (Addgene #83969 ...
-
bioRxiv - Microbiology 2023Quote: ... Human codon-optimized full-length Eph receptors were subcloned from pDONR223-EphB1 (Addgene # 23930 (82)) ...
-
bioRxiv - Cancer Biology 2023Quote: The Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat (Addgene #90294). The library was amplified in bacteria as described in the Moffat protocol on Addgene (https://www.addgene.org/pooled-library/moffat-crispr-knockout-tkov3/) ...
-
bioRxiv - Cancer Biology 2023Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag-FKHR-AAA mutant; Addgene) (15) ...
-
bioRxiv - Cancer Biology 2023Quote: ... we amplified mutant human HIF1/2α using the pcDNA3-HA-HIF1α(P402A/P564A) (Addgene #18955) plasmid and the pcDNA3-HA-HIF2α(P405A/P531A ...
-
bioRxiv - Biochemistry 2023Quote: ... Human DNMT3A1 and DNMT3L constructs were PCR amplified from cDNA expression constructs (Addgene #35521, #35523) and cloned by ligation dependant cloning into x6His-MBP-TEV or 6xHis-MBP-GFP expression vectors ...
-
bioRxiv - Microbiology 2023Quote: The human CUL1 and UBE2L3 coding sequences were amplified from pcDNA-HA-UBE2L3 (Addgene, #27561) and pcDNA-myc3-CUL1 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of human tau isoform 0N4R was subcloned into the pJFRC7 vector (Addgene, plasmid #26220 ...
-
bioRxiv - Cancer Biology 2024Quote: The Human CRISPR Metabolic Gene Knockout library was a gift from David Sabatini (Addgene #110066)78 ...
-
bioRxiv - Cell Biology 2024Quote: Human Pcdhga9 mutants were generated by cloning PCR-amplified fragments into pBob-GFP vector (Addgene). For GFP-tagged constructs ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.