Labshake search
Citations for Addgene :
51 - 100 of 667 citations for MERS Coronavirus Spike Glycoprotein S1 His tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: Escherichia coli NiCo21 (DE3) competent cells were transformed with the plasmid encoding sumo-tag fused DiCas7-11 (Addgene: 172503). A single colony was picked and transferred to 100mL LB media containing 50 μg/mL ampicillin and grown for 12 hours at 37°C before inoculation into 1L LB culture ...
-
bioRxiv - Microbiology 2022Quote: ... Spike ΔC18 (Addgene #: 170442)) ...
-
bioRxiv - Synthetic Biology 2019Quote: A plasmid for SpCas9 expression (2x NLS and C-terminal His tag, pET-28a) was a gift from the Gao group (Addgene #98158).50 E ...
-
bioRxiv - Neuroscience 2020Quote: ... and the VSVG envelope glycoprotein vector pMD2-G (Addgene plasmid #12259) into HEK293T cells ...
-
bioRxiv - Biochemistry 2020Quote: ... and FMRP was purchased as a gene block from IDT. The human sequence (not optimized for E. coli) for FXR1P was purchased from Addgene. The genes coding for the human fragile X proteins (FMRP isoform 1 NCBI Reference Sequence ...
-
bioRxiv - Biophysics 2023Quote: ... was cloned into the pEG-BacMam expression vector with the GFP and 8X-His tags at the C-terminus (Addgene: Table S2). All constructs with large domain insertions and deletions were made using standard protocols for Gibson assembly (New England Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... was expressed in E.coli using a gene with an N-terminal 6×His-tag and an upstream TEV-protease site cloned into pET28a(+) (Addgene plasmid #20061). MSP1D1 was purified using IMAC with further cleavage of 6×His-tag by TEV protease 50,51 ...
-
bioRxiv - Molecular Biology 2024Quote: The human MPST expression plasmid with the N-terminal His tag with TEV cleavage site (MPSTA) was a gift from Nicola Burgess-Brown (Addgene plasmid #42482). This construct was co-expressed with chaperones groEL ...
-
bioRxiv - Molecular Biology 2024Quote: The human MPST expression plasmid with the N-terminal His tag with TEV cleavage site (MPSTA) was a gift from Nicola Burgess-Brown (Addgene plasmid #42482). The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340) ...
-
bioRxiv - Bioengineering 2021Quote: ... The Spike protein from pcDNA3.1-SARS2-Spike was a gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Bioengineering 2020Quote: ... pcDNA3.1-SARS2-Spike (Addgene, #145032) was a gift from Fang Li42 ...
-
bioRxiv - Microbiology 2022Quote: ... Spike-Flag FKO (Addgene #: 159364), Flag-Spike-Flag (Addgene # ...
-
bioRxiv - Microbiology 2022Quote: ... Flag-Spike-Flag (Addgene #: 156418), and David Nemanzee [32] (SARS-CoV Spike ΔC28 (Addgene # ...
-
bioRxiv - Genomics 2019Quote: ... coli expressing Streptococcus Pyogenes Cas9 carrying a C-terminal fusion to a hexa-histidine tag from the pET-28b-Cas9-His plasmid (Addgene http://www.addgene.org/47327) (56) ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC S285C and S329C variants for PRE, insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98665, 98667 respectively)
-
bioRxiv - Biophysics 2023Quote: ... and its variants were cloned into the pEG-BacMam expression vector with GFP and 8X-His tags at the N-terminus (Addgene, see Table S2). For FLAG-tagged KRAS expression constructs ...
-
bioRxiv - Biochemistry 2020Quote: ... coli RP hk339-GFP (monomeric His-tagged Kif5B kinesin motor domain) expression plasmid was a gift from Ron Vale (Addgene plasmid #24431).
-
bioRxiv - Immunology 2022Quote: ... target cells were derived by transfection with plasmids designed to express the SARS-CoV-2 D614 Spike protein with a c-terminus flag tag (kindly provided by Dr. Farzan, Addgene plasmid no. 156420 (Zhang et al., 2020)) ...
-
bioRxiv - Biochemistry 2022Quote: ... The open-reading frames (codon-optimized for expression in E. coli) were cloned into the expression vector p15TV-L (AddGene ID: 26093) under the T7 promoter and in-frame with the N-terminal 6xHisTag (Twist Bioscience) ...
-
bioRxiv - Cell Biology 2022Quote: pcDNA3.1-SARS2-Spike (Addgene plasmid #145032), pCEP4-myc-ACE2 (Addgene plasmid #141185) ...
-
bioRxiv - Molecular Biology 2021Quote: ... or pcDNA3.1-SARS2-Spike (Addgene # 145032) or VSV-G plasmid (Addgene plasmid # 8454 ...
-
bioRxiv - Bioengineering 2021Quote: ... the Spike protein (Addgene plasmid # 145032) was cloned downstream of the TRE3G promoter ...
-
bioRxiv - Bioengineering 2023Quote: ... and Spike-18aa truncated (RRID: Addgene_149541) plasmids ...
-
bioRxiv - Neuroscience 2020Quote: ... pEZYmyc-His (Addgene plasmid #18701 ...
-
bioRxiv - Cancer Biology 2023Quote: ... E-cadherin reporter (pHAGE-E-cadherin-RFP, Addgene #79603), cell cycle reporter (pBOB-EF1-FastFUCCI-Puro ...
-
bioRxiv - Molecular Biology 2021Quote: ... Vesicular Stomatitis Virus glycoprotein (VSV-G) envelope expression vector (pMD2.G; Addgene #12259), lentiviral packaging plasmid (psPax2 ...
-
bioRxiv - Cell Biology 2021Quote: ... SARS-CoV2-Spike plasmids (Addgene, cat.no. 145032) were transfected into cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... Spike-18aa truncated plasmid (Addgene plasmid # 149541) was used as template ...
-
bioRxiv - Microbiology 2022Quote: ... Hyeran Choe [12] (Spike-Flag (Addgene #: 156420), Spike-Flag FKO (Addgene # ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 spike (Addgene #149329), B.1.1.7 SARS-CoV-2 spike (Sino Biological ...
-
bioRxiv - Biochemistry 2023Quote: ... Ttyh1 was expressed from a pLX304 vector after addition of C-terminal Strep and His tags to an existing construct (Addgene #161676, a gift from Mike McManus). To stably express fluorescently tagged Prom1 WT and W795R variants in HeLa cells for live cell imaging ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... pEZYmyc-HIS (Addgene, #18701) or pDEST-myc ...
-
bioRxiv - Cancer Biology 2022Quote: ... ITGA2-HIS (Addgene, #51910), ITGB2-YFP (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... his-hOPTN (Addgene, #23053), mOPTN (mouse tissue cDNA) ...
-
bioRxiv - Cell Biology 2024Quote: ... Eps15-GFP-His (Addgene #170860 ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids encoding the Spike protein were a mixture of (10 µg) of pcDNA3.1-SARS2-Spike (Addgene plasmid 145032) and (3 µg ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Neuroscience 2023Quote: ... with the SAD B19 glycoprotein gene from pCAG-B19G (Chatterjee et al., 2018) (Addgene 59921) and either the mCre ...
-
bioRxiv - Cell Biology 2022Quote: The Spike gene was cleaved from pcDNA-Spike plasmid and cloned into lentiviral vector pLV-mCherry (Addgene, Watertown, MA, USA) with removal of mCherry gene to generate pLV-Spike plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid pBP_lacZ (Table S1; Addgene accession number 72948) and the purified PCR fragment were digested using SphI and NdeI ...
-
bioRxiv - Microbiology 2020Quote: The SNAP-tag gene was PCR amplified from pSNAP-tag(m) (Addgene #101135) and cloned into pVpr-IN.eGFP(Albanese et al. ...
-
bioRxiv - Immunology 2021Quote: pcDNA3.1-SARS-CoV-2 Spike (Addgene plasmid #145302) was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio) ...
-
bioRxiv - Microbiology 2023Quote: ... and pDONR223 SARS-CoV-2 spike (Addgene #149329) were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223 ...
-
bioRxiv - Immunology 2021Quote: ... was generated by deletion of last 19aa of Spike starting from pcDNA3.1-SARS2-Spike (a gift from Fang Li, Addgene plasmid # 145032). pLenti CMV-GFP-TAV2A-LUC Hygro was generated from pLenti CMV GFP Hygro (Addgene #17446 ...
-
bioRxiv - Immunology 2022Quote: SARS-CoV-2 spike-pseudotyped lentiviruses encoding a luciferase-ZsGreen reporter were produced using the same method but with plasmids encoding SARS-CoV-2 spike (HDM-SARS2-spike-delta21, Addgene #155130) or its variants of concern ...
-
bioRxiv - Systems Biology 2021Quote: ... The pMEL16 (His-, Addgene 107922) and p414-TEF1p-Cas9-CYC1t (hereafter referred to as P414 ...
-
bioRxiv - Bioengineering 2023Quote: HIS-tagged HER2 (Addgene #16257) was expressed using the Expi293™ expression system (Thermo Fisher ...
-
bioRxiv - Neuroscience 2020Quote: ... the following 21-mer shRNA inserts were cloned separately in the pLKO.3G vector (Addgene plasmid #14748): scrambled shRNA (CCTAAGGTTAAGTCGCCCTCG) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20-mer seed sequences with a prepended “G” were restriction cloned into BsmBI-digested sgOpti (Addgene #85681). Inducible dCas9-KRAB expressing cells were transduced in triplicate with sgOpti lentivirus and divided at 24 hours into media with 1 ug/mL puromycin with or without 500 ng / mL doxycycline ...