Labshake search
Citations for Addgene :
1 - 50 of 2820 citations for Human Immunodeficiency Virus Reverse Transcriptase Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: Plasmid for HIV-1 reverse transcriptase expression: pCMV-dR8.2 dvpr was a gift from Bob Weinberg (Addgene plasmid # 8455 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then infected with human telomerase reverse transcriptase (hTERT)-containing lentivirus (AddGene) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Mammalian expression vectors for FGFR2-IIIb (pBp-FGFR2b-WT, Addgene plasmid # 45698), FGFR2-IIIc (pBp-FGFR2c-WT ...
-
bioRxiv - Microbiology 2022Quote: ... psPAX2 (HIV-1 gag/pol) (Addgene) and pMD2.G (encoding VSV-G ...
-
bioRxiv - Neuroscience 2023Quote: ... HIV-1 Rev (pRSV-Rev Addgene: 12253), and VSV g-glycoprotein Env (pMD2.G Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... CAFs were immortalized with stable expression of human telomerase reverse transcriptase (pBABE-neo-hTERT was a gift from Bob Weinberg (Addgene plasmid # 1774 ...
-
bioRxiv - Cancer Biology 2019Quote: ... WT or Mutant FGFR2 IIIb ORFs were cloned into pInducer20 Tetracycline-inducible lentiviral vector (Addgene #44012) using gateway cloning technology (Invitrogen #11791019) ...
-
bioRxiv - Immunology 2021Quote: ... and HIV-1- gag-pol helper plasmid (pspax2, Addgene) using Lipofectamine 3000 according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... 250nl of an anterograde adeno-associated virus (AAV) vector expressing a green fluorescent protein under the hSyn (human synapsin) promoter (AAV5-hSyn-eGFP; Addgene) was injected into ACC to fluorescently mark the anatomical boundary of the claustrum (White et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Vesicular stomatitis virus G protein (VSV-G) pseudotyped lentiviruses expressing human ACE2 were produced by transient co-transfection of pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Genomics 2022Quote: ... and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Microbiology 2022Quote: ... HIV-1 GagPol was expressed by pCMV ΔR8.2 (Addgene plasmid # 12263). The protease mutations D25N and R57G were generated by overlapping PCR using pCMV ΔR8.2 as a template ...
-
bioRxiv - Genetics 2020Quote: ... The Cas9 nickase-reverse transcriptase plasmid (pCMV-PE2, Addgene #132775, Watertown, MA) was linearized with PmeI (New England Biolabs #R0560S ...
-
bioRxiv - Cell Biology 2022Quote: ... HIV-1-GAG fused with EGFP was purchased from Addgene (plasmid 80605). Ezrin plasmid was a generous gift of Adam Kwiatkowski (University of Pittsburgh School of Medicine ...
-
bioRxiv - Microbiology 2024Quote: The full-length HIV vectors NL4-3 ΔEnv EGFP (HIV Reagent Program) and HIVGKO (Addgene plasmid #112234) were produced in HEK293T cells along with the VSV-G (Addgene plasmid # 8454 ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid pCMV delta R8.2 encoding HIV-1 GagPol (Addgene, plasmid #12263) using Fugene 6 (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... and a plasmid pCMV delta R8.2 encoding HIV-1 GagPol (Addgene, plasmid # 12263) using FuGENE 6 (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... The M-MLV* reverse transcriptase in ciPE2 was PCR-amplified from pCMV_PE2 (Addgene #132775), a gift from David Liu ...
-
bioRxiv - Cancer Biology 2020Quote: ... packaging plasmid HIV-gag-pol (Addgene 14887) and envelope plasmid pUVSVG (Addgene 8454 ...
-
Evolutionary plasticity of SH3 domain binding by Nef proteins of the HIV-1/SIVcpz lentiviral lineagebioRxiv - Microbiology 2021Quote: ... and HIV-1 P RBF168) were cloned into the pWPI-GFP vector (Addgene # 12254) to transduce Jurkat cells stably expressing CD4.
-
bioRxiv - Cell Biology 2023Quote: ... For retroviral transfections 1 μg VSVG and 1.86 μg HIV gag-pol (Addgene #14887) were used ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.7-1 μL of virus (AAV2-CMV-mCreb, 1×1012 Addgene Plasmid #68551 ...
-
bioRxiv - Immunology 2022Quote: ... an HIV gag-pol packaging plasmid (Addgene #8455), and a lentiviral transfer plasmid encoding firefly luciferase (Addgene #170674 ...
-
bioRxiv - Immunology 2021Quote: ... an HIV gag-pol packaging plasmid (Addgene #8455), and a lentiviral transfer plasmid encoding firefly luciferase (Addgene #170674 ...
-
bioRxiv - Immunology 2024Quote: ... an HIV gag-pol packaging plasmid (Addgene #8455), and a transfer plasmid encoding firefly luciferase (Addgene #170674 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were transfected with plasmid pLXSN16E6E7 encoding the human papilloma virus HPVE6E7 gene (Addgene #52394) as described [18] ...
-
bioRxiv - Cancer Biology 2024Quote: ... and p73C proteins were subcloned into pET15-b (Addgene, #24866), pET28-a ...
-
bioRxiv - Neuroscience 2023Quote: ... and pZac2.1 gfaABC1D-lck-GCaMP6f virus (Addgene virus #52924).
-
bioRxiv - Neuroscience 2020Quote: ... The virus (Addgene plasmid pAAV-hSyn-Flpo ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Cell Biology 2019Quote: ... Human B-Raf under T7 promoter was a gift from Dustin Maly (Addgene #40775) and was further modified by the insertion of two additional FLAG tags and of an RBS sequence ...
-
bioRxiv - Microbiology 2022Quote: ... pCMV encoding HIV-1 Vpr fused to beta lactamase (pCMV4-BlaM-Vpr) was obtained from Addgene (21950). A plasmid encoding replication-incompetent HIV-1 lacking env and vpr and encoding luciferase (pNL4-3LucR-E- ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... CACCGGATCGGCCAGAGTTACTCC; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC) genes were subcloned into pLentiguide puro (Addgene). sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1 ...
-
bioRxiv - Immunology 2022Quote: HIV-based lentivirus backbone plasmid pCMV-dR8.2 dvpr (Addgene #8455), pBOB-Luciferase (Addgene #170674 ...
-
bioRxiv - Immunology 2023Quote: ... together with an HIV gag-pol packaging plasmid (Addgene #8455), and a transfer plasmid encoding firefly luciferase (Addgene #170674 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reference sgRNA sequences for human GeCKO v2.0 (A and B) were downloaded from Addgene (https://www.addgene.org/pooled-library/) ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid mixes to produce HIV-1 viral particles consisted of 0.4 μg CMV-VSVG (pMD2.G; 12259; Addgene) and 2.6 μg of HIV proviral plasmid ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G, Addgene plasmid #12259), 0.25 µg of a plasmid encoding for the transactivating protein Rev (pRSV-Rev ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus (AAV1-S5E2-jGCaMP6f; Addgene #135632-AAV1; diluted 1:3 in saline) was injected into the RSC (AP ...
-
bioRxiv - Neuroscience 2023Quote: ... a 1 μL dot of AAV9/hSyn/GCaMP6f virus (Addgene, Watertown, MA) diluted 1-5x from commercial titer (2.8x1013 to ∼1x1012 units/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... We then injected the AAV5.CamKII.GCaMP6f.WPRE.SV40 virus (Addgene # 100834; 200 nL at 1 nl.s-1) in hippocampal CA1 using the following coordinates ...
-
bioRxiv - Neuroscience 2020Quote: ... P5-7 WT C57Bl/6 mice were used for the injection of AAV9 virus under human synapsin promoter (pAAV9.hSyn.iGluSnFR, commercially available from Addgene, USA) to drive transgenic expression of iGluSnFR in SGNs ...
-
bioRxiv - Developmental Biology 2021Quote: ... The reference sgRNA library sequences for human GeCKO v2.0 (A and B) were downloaded from Addgene (https://www.addgene.org/pooled-library/) ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Microbiology 2020Quote: The lentiviral vector was prepared by recovering the culture supernatant of 293T cells transfected with CSII-CMV-FNF-DsRed together with expression plasmids for HIV-1 Gag-Pol and Rev (pCMVR8.74, Addgene plasmid #22036 ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 dual reporter vector expressing mCherry and luciferase (NL4-3 mCherry Luciferase, plasmid#44965) was purchased from Addgene. Plasmid expression a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19 ...
-
bioRxiv - Immunology 2023Quote: ... a 4-1BB costimulatory domain and the CAR construct utilized for animals R.301-304 additionally expressed EGFRt.23 CARs were encoded by an xHIV plasmid which was co-transfected with an HIV-1 Rev/Tat and VSV-G envelope plasmid (RRID:Addgene_138479) for lentiviral production as previously described.23
-
bioRxiv - Genetics 2020Quote: Prime Editor 2 (PE2) plasmid coding for the SpCas9 gene fused with the MLV reverse transcriptase was obtained from Addgene Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV-CamKII-Cre virus (Addgene) was diluted 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus was obtained from Addgene. During surgery ...