Labshake search
Citations for Addgene :
351 - 400 of 2820 citations for Human Immunodeficiency Virus Reverse Transcriptase Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Plasmids for human LINE-1 expression: pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288 ...
-
bioRxiv - Molecular Biology 2023Quote: ... an shRNA targeting human UNK gene was cloned in the pLKO.1 puro plasmid (Addgene_8453) between AgeI and EcoRI sites61 ...
-
bioRxiv - Biophysics 2019Quote: ... human DCX (Addgene #83928), mouse DCLK1 (Transomics #BC133685) ...
-
bioRxiv - Cell Biology 2020Quote: ... human c-MYC (RRID:Addgene_17220) and ESRG (6 μg each ...
-
bioRxiv - Genomics 2019Quote: ... shRNAs against KAP1 (shKAP1-B and shKAP1-D) were cloned into the pLKO.1.puro vector obtained from Addgene (http://www.addgene.org) using AgeI and EcoRI sites ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Neuroscience 2019Quote: ... Lck-GFP virus— pAAV.GfaABC1D.PI.Lck-GFP.SV40—was a gift from Baljit Khakh (Addgene viral prep # 105598-AAV5). AAV2/5 GfaABC1D.mCherry was obtained from Vector Biolabs ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... Control animals were injected with a control virus (pAAV-CMV-PI-eGFP-WPRE-bGH; Addgene; #105530). For both experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... we injected ∼0.5 μl of anterograde trans-synaptic virus (AAV1-hsyn-Cre, Addgene Cat# 105553-AAV1) into the right DMS (bregma 0 mm ...
-
bioRxiv - Neuroscience 2020Quote: ... we drilled a small hole in the skull and injected ??nl of an AAV virus pAAV.Syn.GCaMP6f.WPRE.SV40 (AAV9; from Addgene) using a glass pipette ...
-
bioRxiv - Neuroscience 2020Quote: ... The virus pZac2.1 gfaABC1D-cyto-GCaMP6f was a gift from Baljit Khakh (Addgene plasmid cat.# 52925). Viral infections were performed at upto 20×109 viral particles as final concentration in 200µL volume per well ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV5 CaMKII-hM3Dq-IRES-mCitrine (3.75×10^14 or 3.75×10^13 virus molecules/mL) (Addgene plasmid #50466 ...
-
bioRxiv - Neuroscience 2022Quote: We injected bilaterally 600μL channelrhodopsin-infused retrograde adeno associated virus pAAV-Syn-ChR2(H134R)-GFP (Addgene) in ventral hippocampus (A/P ...
-
bioRxiv - Neuroscience 2022Quote: ... We then used adeno-associated virus AAV1 carrying the construct GCaMP6s under the CaMKIIα promoter (Addgene# 107790-AAV9 ...
-
bioRxiv - Physiology 2022Quote: ... The control virus AAV2/5-hSyn-DIOmCherry was ordered from Penn Vector Core (Addgene plasmid 50459). Animals were allowed to recover from stereotaxic surgery for a minimum of 21 days before initiation of any experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... we infected 4 DIV neurons with adeno-associated virus (AAV) expressing CamK2a-Cre (Addgene# 105558-AAV1) - pENN.AAV.CamKII 0.4.Cre.SV40 was a gift from James M ...
-
bioRxiv - Neuroscience 2023Quote: ... 150-200nl of Cre- and Flp-dependent virus AAV8-hSyn-Con/Fon-EYFP (Addgene #55650-AAV8) was unilaterally injected into the MPN (AP 0 ...
-
bioRxiv - Neuroscience 2023Quote: ... all mice received injections of a hM3Dq virus (pAAV-S5E2-Gq-P2A-dTomato; Addgene #135635-AAV1)58.
-
bioRxiv - Neuroscience 2023Quote: ... unilateral injections of a virus designed to Cre-dependently express GCaMP6s (AAV1.Syn.Flex.GCaMP6s.WPRE.SV40, Addgene, 100845-AAV1) were performed in the arcuate nucleus of the hypothalamus (ARC ...
-
bioRxiv - Neuroscience 2023Quote: ... with the rabies virus genomic vectors that contained either mCherry (pSADdeltaG-F3-mcherry, Addgene plasmid #32634), or GFP and Synaptophysin-RFP cDNA (pRVdG-N-P-M-EGFP-SynPhRFP-L ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-week-old Vglut2-Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Immunology 2022Quote: ... pTwist-SARS-CoV-2 Δ18 B.1.351v1 (Addgene, no.169462) for Beta-S protein was a gift from Alejandro Balazs26 ...
-
bioRxiv - Neuroscience 2022Quote: ... pZac2.1-GfaABC1D-mCherry-hPMCA2w/b plasmid was ordered from Addgene.
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
Multi-omics characterization of partial chemical reprogramming reveals evidence of cell rejuvenationbioRxiv - Molecular Biology 2023Quote: ... or the reverse tetracycline transactivator36 (Addgene #20342), were encapsulated in PureFection nanoparticles (System Biosciences ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3.1 Dynamin 1 (human, p880) was a gift from Sandra Schmid and was obtained from Addgene (Addgene plasmid #34682 ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Neuroscience 2021Quote: ... Univ of Pennsylvania) (Herman et al. 2016) and CaMKII-Cre virus (pENN-AAV9-CaMKII-Cre-SV40; Addgene, Watertown ...
-
bioRxiv - Neuroscience 2021Quote: ... was loaded with the GCaMP6s virus (AAV9.Syn1.GCaMP6s.WPRE.SV40, ≈1.9x1013 GC/ml, Penn Vector Core; RRID: Addgene_100843) and was slowly lowered into VTA (DV -8.1 mm relative to brain surface) ...
-
bioRxiv - Neuroscience 2022Quote: ... Circuit-specific viral expression was achieved using the retrograde properties of adeno-associated virus (AAV) serotype 5 23: AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540). Sparse labelling was obtained using Cre-inducible ...
-
bioRxiv - Neuroscience 2020Quote: ... the virus used was AAV8-CaMKIIα-hM3D(Gq)-mCherry (Addgene viral prep # 50476-AAV8, Addgene, Cambridge, MA). In the GFP (null virus ...
-
bioRxiv - Neuroscience 2020Quote: ... the virus used was AAV8-CaMKIIα-hM4D(Gi)-mCherry (Addgene viral prep # 50477-AAV8, Addgene, Cambridge, MA). In the Gq experiment ...
-
bioRxiv - Molecular Biology 2020Quote: ... These cells were spin transfected for 2h at 1000g with 82*10E6 Brunello virus particles (LentiCRISPRv2, Addgene 73179-LV ...
-
bioRxiv - Neuroscience 2020Quote: A retrogradely-transported adeno-associated virus carrying Cre recombinase (AAV pmSyn1-EBPF-Cre, abbreviated retro-Cre; Addgene viral prep #51507-AAVrg ...
-
bioRxiv - Physiology 2021Quote: ... Cre-positive mice received the AAV-hM4D injection (test mice) or a control virus AAV-YFP (Addgene) (control mice) ...
-
bioRxiv - Neuroscience 2020Quote: ... we injected ∼0.5 μl of retrograde adeno-associated virus expressing tdTomato51 (retroAAV-tdTomato, Addgene Cat# 59462-AAVrg) into the right ACC (bregma +1.2 mm ...
-
bioRxiv - Neuroscience 2020Quote: All optogenetic behavioral manipulations were conducted with bilateral virus injections of AAV2-hSyn-ChR2-EYFP (500nL, Addgene) into either ALM (AP 2.90 ...
-
bioRxiv - Neuroscience 2022Quote: ... we infected the neurons with the retrograde virus pGP-AAVrg-syn-jGCaMP7s-WPRE (Addgene, Plasmid #104487-AAVrg). Injections (450 μL ...
-
bioRxiv - Neuroscience 2022Quote: ... A small volume (0.4 μl total) of virus (AAV8-EF1α-CreOn/FlpOn-GCaMP6f (RRID:Addgene_137122, titer 6.10E+13) for Aldh1a1-iCre/Th-Flpo and VGlut2-IRES-Cre/Th-Flpo mice ...
-
bioRxiv - Neuroscience 2022Quote: ... Cre-positive mice received the AAV-ChR2 injection (test mice) or a control virus AAV-YFP (Addgene) (control mice) ...
-
bioRxiv - Neuroscience 2022Quote: Tobfl/fl mice were bilaterally injected with Cre-expressing adeno-associated virus AAV1.hSyn.Cre.WPRE.hGH (105553-AAV1, Addgene) to generate hippocampus-specific KO mice ...
-
bioRxiv - Genomics 2022Quote: ... Wild-type (J1) mESCs were transduced with Cas9-blast virus (generated from pLentiCas9-Blast, Addgene ID: 52962) and selected with 10μg/ml blasticidin (InvivoGen ...