Labshake search
Citations for Addgene :
201 - 250 of 383 citations for Histone Lysine N Methyltransferase EZH2 EZH2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... cDNA encoding wild-type human ubiquitin containing an N-terminal HA-tag was expressed from pRK5-HA (Addgene). Full-length EGFP fused N-terminally to a nuclear localization signal (NLS ...
-
bioRxiv - Immunology 2022Quote: ... The MSCV-N EBNA3A plasmid used as a backbone for PCR was a gift from Karl Munger (Addgene plasmid # 37956 ...
-
bioRxiv - Cell Biology 2019Quote: ... EGFP-vinculin head (residue 1-258) and the N-terminal fusion of vinculin-T12 were obtained from Addgene (#46270 ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ; http://n2t.net/addgene:57461; RRID:Addgene_57461). CMV::SypHy A4 was a gift from Leon Lagnado (Addgene plasmid # 24478 ...
-
bioRxiv - Cancer Biology 2020Quote: Expression plasmid encoding N-terminally Flag-tagged hFOXO1-3A (#13508) was purchased from Addgene (Cambridge, MA, pCDNA3 backbone). FOXO1-3A has Ala residue substitutions at Thr-24 ...
-
bioRxiv - Molecular Biology 2023Quote: ... before using LR reaction to transfer the cDNA into destination vectors pLEX_305-C-dTAG or pLEX_305-N-dTAG (Addgene #91797 & #91798 ...
-
bioRxiv - Molecular Biology 2023Quote: ... To tag endogenous POLQ at the N-terminus with a 3xFLAG-LoxP-SV40-Puro-Lox-HaloTag (Addgene #86843), ∼ 5 × 105 U2OS cells were transfected using FuGene6 (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... Digested gBlocks were ligated to digested pGEX-6p1-N-HA (gift from Andrew Jackson & Martin Reijns, Addgene plasmid # 119756; http://n2t.net/addgene:119756; RRID:Addgene_119756). BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848; http://n2t.net/addgene:122848 ; RRID:Addgene_122848). pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid for STIM1-mApple was prepared in our lab as described previously123 and that for mEmerald-TOMM20-N-10 was a gift from Michael Davidson (http://n2t.net/addgene:54282 ; RRID:Addgene_54282).
-
bioRxiv - Developmental Biology 2023Quote: ... The full-length RUVBL1 with N-terminal 3×FLAG tag (pCDNA-3xFLAG-Pontin) was obtained from Addgene (51635). All cell lines were grown in DMEM (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... The constructs were LR-recombined into pDest-pcDNA3.1 with N-terminal FLAG-tag or into pLIX_403 (Plasmid #41395, Addgene) with C-terminal GFP-tag ...
-
bioRxiv - Microbiology 2024Quote: ... N/Tert-1 Cas9 knockout cells were generated by transduction with a spCas9 lentiviral expression vector (Addgene # 52962) and selecting with blasticidin ...
-
bioRxiv - Biochemistry 2023Quote: ... pDEST-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122842; http://n2t.net/addgene:122842; RRID:Addgene_122842) (78).
-
bioRxiv - Biophysics 2023Quote: ... or an N-terminal TEV protease-cleavable His6-tag (UC Berkeley Macrolab vector 2B-T, Addgene ID 29666). For coexpression ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3-N-HA-NEK7 and pcDNA3-N-HA-NEK7K64M were gifts from Bruce Beutler (Addgene plasmid # 75142 ; http://n2t.net/addgene:75142 ; RRID:Addgene_75142) and (Addgene plasmid # 75143 ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were co-transfected with pcDNA3.0 plasmids containing human CDC50A (NM_018247, N-terminal FLAG tag; RRID: Addgene_203694) and ATP10B variants (O94823.2 ...
-
bioRxiv - Cell Biology 2019Quote: ... The donor plasmid to insert mEGFP into the N-terminus of lamin B1 was purchased from Addgene (Cat# 87422). TrueCut Cas9 protein v2 and TrueGuide 1-piece modified synthetic gRNA (GGGGTCGCAGTCGCCATGGC ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
-
bioRxiv - Cell Biology 2019Quote: ... Lamin A-mEmerald (mEmerald-LaminA-N-18) and NLS-mCherry (mCherry-Nucleus-7) were gifts from Michael Davidson (Addgene plasmids #54139 and #55110 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Genomics 2021Quote: Individual effectors were fused at the N-terminus to the PYL1 domain (gift from Jerry Crabtree, Addgene plasmid #38247) and sfGFP ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521; http://n2t.net/addgene:12521; RRID: Addgene_12521). The pLPC-puro-N-Flag-NELFE plasmid was obtained by amplification of the human NELFE cDNA (obtained from gene synthesis ...
-
bioRxiv - Cell Biology 2021Quote: ... Gateway recombination of the destination vector pLVpuro-CMV-N-APEX2-EGFP with the entry clone pDONR223 LC3B WT (Addgene plasmid # 123072 ...
-
bioRxiv - Molecular Biology 2022Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pGL3-U6-sgRNA-PGK-puromycin and pST1374-N-NLS-flag-linker-Cas9-D10A were gifts from Xingxu Huang (Addgene plasmid # 51133 ...
-
bioRxiv - Cell Biology 2019Quote: ... and mEmerald-IFT88-N-18 was a gift from Michael Davidson (Addgene plasmid # 54125; http://n2t.net/addgene:54125; RRID: Addgene_54125).
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: ... full-length Prdm16 overexpressing plasmid with an in-frame N-terminal FLAG tag was purchased from Addgene (Addgene #15504). Full-length Dnmt1 cDNA clone was obtained from Open Biosystems and further subcloned into the pLVX lentiviral expression vector (Clontech ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Biochemistry 2021Quote: ... Jürg Müller (for generation of pcDNA5.1-FRT/TO-puro-(N)GFP-TEV-FLAG-3C-BAP1) or originated from Wade Harper’s laboratory obtained from Addgene (for generation of pcDNA5-FRT/TO-puro-eGFP-BAP1) ...
-
bioRxiv - Neuroscience 2022Quote: ... PV mice (n=9) were infused with AAV9-CAG-FLEX-SomArchon-GFP (titer: 6.3×1012 – 1.1×1013 GC/mL, Addgene #126943) or AAV9-synapsin-FLEX-SomArchon-GFP (titer ...
-
bioRxiv - Neuroscience 2022Quote: ... Most CaMKII mice (n=4) were infused with AAV9-CaMKII-SomArchon-GFP (titer: 3.2×1012 GC/mL, Addgene #126942), and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer ...
-
bioRxiv - Neuroscience 2023Quote: ... Rats intended for fiber photometry experiments (n=11 females) received unilateral infusions of AAV9 FLEX-GCaMP6f (0.4uL, titer ∼1.4 × 1013 GC/mL, Addgene #100833) into the VP and retro-AAV Cre (0.4uL ...
-
bioRxiv - Biochemistry 2023Quote: ... Linker SAM variants with N terminal HisSUMO-tag were assembled in a pET vector (starting from Addgene Plasmid #111559) for recombinant expression in E ...
-
bioRxiv - Cancer Biology 2023Quote: ... and WDR6 (N-6xHis) coding sequences were codon-optimized for e.coli bacteria and cloned separately into petDuet-1 (purchased from Addgene) using the NcoI site downstream of the first T7 promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... from where it was subcloned into a pGEX-4T1 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_208870). For expression of unlabeled NAP1 in E ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a pGEX-4T1 vector with an N-terminal MBP-tag followed by a TEV cleavage site before wild-type NAP1 (RRID:Addgene_208871), NAP1 delta-NDP52 (S37K/A44E ...
-
bioRxiv - Cell Biology 2023Quote: ... Human NDP52 cDNA was cloned into a pGST2 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_187828). After the transformation of the pGST2 vector encoding GST-TEV-NDP52 in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Cell Biology 2024Quote: ... enables GFP and APEX to be targeted to cilia in many cell types via the N-terminal 203 residues of NPHP3 and was a gift from Maxence Nachury (RRID:Addgene_73186) (Mick et al ...
-
bioRxiv - Cell Biology 2022Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...
-
bioRxiv - Immunology 2019Quote: ... The MPO-mEmerald gene was incorporated into an expression vector by first digesting the mEmerald-MPO-N-18 plasmid (Addgene plasmid #54187 ...
-
bioRxiv - Cancer Biology 2020Quote: ... modified to express human histone H2B tagged at the N-terminus with GFP (pLVX-myc-EmGFP-H2B) plus psPAX2 and pMD2.G (gifts from Didier Trono, Addgene) using 16.6 mM CaCl2 in DMEM supplemented with 10% Hyclone™ serum (GE Healthcare ...
-
bioRxiv - Biophysics 2019Quote: Expression of N-terminally acetylated human αS and βS proteins was performed via co-expression with pNatB plasmid (Addgene #53613) in E ...
-
bioRxiv - Biophysics 2021Quote: The construct for the adaptor protein mTurquoise-SRC-N-18 (SRC with mTurquoise fused to its C-terminus via a linker) was a gift from Michael Davidson (Addgene plasmid # 55560 ...
-
bioRxiv - Cancer Biology 2020Quote: ... A549 cells were retrovirally transduced with a construct coding for the N-terminus of 53BP1 fused to the sequence coding for fluorescent mCherry-protein (Addgene Catalog # 19835 ...
-
bioRxiv - Neuroscience 2020Quote: ... viral vectors encoding DREADDs for ChI manipulation were infused into the NAcore of ChAT::cre animals: AAV5-hsyn-DIO-HM4D(Gi)-mCherry (inhibitory; titer: 1.2×1013 vg/mL; N=15 [Addgene, #44362]), AAV5-hsyn-DIO-rM3D(Gs)-mCherry (excitatory ...
-
bioRxiv - Molecular Biology 2020Quote: A pET28a vector with sub-cloned cDNA of Hsp53-(1-73) (72R) and the N-terminal His-tag was procured from Addgene, (plasmid #62082) ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...