Labshake search
Citations for Addgene :
101 - 150 of 383 citations for Histone Lysine N Methyltransferase EZH2 EZH2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... we initially electroporated with a pCAGGS-mCherry plasmid (Addgene n°41583) in CNC or TNC cells at 7ss and 14ss ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...
-
bioRxiv - Biochemistry 2023Quote: ... pDEST-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122842 ...
-
bioRxiv - Molecular Biology 2020Quote: ... We built plasmids by Gibson assembly for constitutive expression of histones and K27M mutant histones tagged at their C-termini with 2XFLAG epitope tags using the Copia promoter from the plasmid pCoPURO (Addgene 17533), and Drosophila H3 and H3.3 histones from previously published constructs (Ahmad & Henikoff ...
-
bioRxiv - Molecular Biology 2020Quote: ... All cell lines used to assess mitotic progression (Figures 5 and S7) were generated by co-transfecting pcDNA3 encoding mCherry-tagged Histone H2B (Addgene: 20972) and pcDNA3 encoding GFP-tagged Lamin B1 (a kind gift from David Vaux) ...
-
bioRxiv - Developmental Biology 2021Quote: ... N-terminal KRAB-dCas9 (a gift from Bruce Conklin, Addgene plasmid # 73498) fused with a destabilising domain ...
-
Rhes protein transits from neuron to neuron and facilitates mutant huntingtin spreading in the brainbioRxiv - Neuroscience 2021Quote: ... pEGFP-N-Drd1 plasmid was a gift from Kirk Mykytyn (Addgene, 104358), GFP-DRD2 plasmid was a gift from Jean-Michel Arrang (Addgene ...
-
bioRxiv - Biochemistry 2019Quote: ... coli Destination vector pDest-566 (N-terminal His6-MBP tag, Addgene #11517). Final baculovirus expression clones were transformed into DH10Bac cells (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2019Quote: ... mCherry-SiT-N-15 plasmid was a gift from Michael Davidson (Addgene plasmid # 55133 ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting PCR product was inserted into pLVpuro-CMV-N-EGFP (Addgene plasmid # 122848 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Cell Biology 2019Quote: ... and mEmerald-IFT88-N-18 was a gift from Michael Davidson (Addgene plasmid # 54125 ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Neuroscience 2019Quote: ... an eGFP-only reporter without DREADDs (n=7; Addgene: AAV2-hSyn-eGFP), was employed in a group of control rats [65–67].
-
bioRxiv - Cancer Biology 2021Quote: ... and pcDNA3-RLUC-POLIRES-FLUC (a gift from N. Sonenberg; Addgene #45642) (Poulin et al. ...
-
bioRxiv - Microbiology 2020Quote: ... pCAG-VSV-N (#64087) and pCAGGS-T7Opt (#65974) were ordered from Addgene. S expressing pCAGGS vectors were used for the production of pseudoviruses ...
-
bioRxiv - Immunology 2022Quote: ... pVitro-hygro-N-myc-hVps34/Vps15-C-V5-his-plasmid (Addgene #24055), pEGFP-Atg14L (Addgene #21635 ...
-
bioRxiv - Cancer Biology 2022Quote: ... FRA1 sequence from p6599 MSCV-IP N-HAonly FOSL1 vector (Addgene, 34897) was cloned into pLV-EF1α-IRES-puro vector (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the SMARCAL1 coding sequence was cloned into pLEX_305-N-dTAG (Addgene #91797) by the Gateway system (Life Technologies/Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid pKAN-PCUP1-9myc-AID*(N) from Addgene (Morawska and Ulrich, 2013), and plasmid pGIK43 from Georgios Karras.
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear marker H2B-miRFP703 is a fusion of the human H2B clustered histone 11 (H2BC11) with the monomeric near-infrared fluorescent protein miRFP703 (Shcherbakova et al. 2016) (Addgene plasmid #80001). ERK-KTR-mRuby2 ...
-
bioRxiv - Cell Biology 2019Quote: ... pCytoplasm GFP was constructed by inserting PCR fragments of histone H3 promoter and the GFP ORF sequentially into the backbone vector pFGL1010 (Addgene #119081, sulfonylurea resistance); NOX1 and NOX2 deletion constructs were generated by inserting PCR amplified 5’ UTR and 3’ UTR fragments of the target genes sequentially into backbone vector pFGL821 (Addgene #58223 ...
-
bioRxiv - Cell Biology 2020Quote: ... Each transfection consisted of 250 ng expression plasmid (pcDNA3-control (Addgene; n/a), pcDNA3-Sox2FLAG (homemad) ...
-
bioRxiv - Cell Biology 2019Quote: ... mVenus-VE-Cadherin-N-10 (Addgene plasmid # 56340; http://n2t.net/addgene:56340; RRID:Addgene_56340) was a gift from Michael Davidson and was used as acquired ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234 ...
-
bioRxiv - Biophysics 2021Quote: ... was a gift from Michael Davidson (mApple-MAPTau-N-10, Addgene plasmid # 54925). Using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected overnight in 10cm plates with N-GFP-RelA (Addgene #23255) or C-Flag-Rela (Addgene #20012 ...
-
bioRxiv - Cell Biology 2020Quote: mRuby2-MannII-N-10 was a gift from Michael Davidson (Addgene plasmid # 55903)(83) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... a chimeric coding sequence consisting of an N’-terminal HiBit (pEPYC0CM0258, Addgene T.B.C.) the uidA coding sequence ...
-
bioRxiv - Genetics 2020Quote: ... Dapi labelled the nuclei and m-Cherry-TNGP-N-10 (Addgene, Cat # 55145) localized the Golgi ...
-
bioRxiv - Cell Biology 2022Quote: ... The MAP4K4 sequence was cloned into a pLVpuro-CMV-N-EGFP (Addgene, #122848) lentiviral plasmid using the gateway system ...
-
bioRxiv - Microbiology 2023Quote: ... The codon-optimized HCoV-OC43 N sequence was amplified from plasmid # 151960 (Addgene) with primers HCoV-OC43-N c-opt(pLVX)_Fw (gaattcgccgccaccatgtccttcaccccggg ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... The LMP1 coding region was amplified from MSCV-N LMP1131 (Addgene plasmid #37962) and cloned into pRetroX-IRES-ZsGreen via Gibson Assembly ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pMXs-Hu-N-Myc and pMXs-Hu-L-Myc plasmids were obtained from Addgene. The pCCL-WSB1 and pCCL-c-Myc plasmids were purchased from Genscript ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Biochemistry 2019Quote: ... and pFLAG-SREBP2Nt (N-terminal transcriptionally active domain, amino acids 1-482) (Addgene, 26807) were used to transfect cells (HEK293) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pDEST-CMV-N-mCherry was a gift from Robin Ketteler (Addgene plasmid # 123215) (Agrotis ...
-
bioRxiv - Neuroscience 2021Quote: ... and tTA from pAAV::TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA (Addgene #92392) by the conventional PCR reactions ...
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were AAV5-TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA (Addgene plasmid #92392), AAV5-M13-TEV-C-P2A-tdTomato (Addgene plasmid #92391) ...
-
bioRxiv - Biochemistry 2021Quote: ... and pGAT2 (N-terminal polyhistidine and GST tags; Addgene #112588; last three genes (61)) by Twist Bioscience ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pLVU/GFP and pLEX_305-N-dTAG lentiviral plasmid vectors were from Addgene (#24177, #91797). pHTN HaloTag CMV-neo and pHTC HaloTag CMV-neo vectors were from Promega (G7721 ...
-
bioRxiv - Neuroscience 2023Quote: ... rats received infusions of 500 nL of AAV5-hsyn-ChR2-eYFP (n= 22; Addgene 26973 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21(DE3) expression strains containing GST-Hsp90 N(9–236) plasmid (Addgene: 22481) were grown in 1 l LB media supplemented with 100 μg/ml ampicillin at 25 °C and shaking (200 r.p.m. ...