Labshake search
Citations for Addgene :
301 - 350 of 485 citations for Dl 4 Methoxyestradiol 13 14 15 16 17 18 13C6 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg of pCMV-VSV-G (Addgene #8454) and 7.5 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Genetics 2021Quote: ... 16 ml of Opti-MEM was mixed with 72 μg of base editor encoding plasmid (ABE8e, Addgene #138489 or ABE8.20-m, Addgene #136300), 8 μg of pCS-GFP plasmid and 800μl Plus reagent ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing the target proteins were dialyzed against PBS (pH 7.4) and the His6-SUMO-tag was removed by enzymatic cleavage using human SENP1 protease at 4°C overnight (Addgene #16356) (51) ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-LRRK2 L350-L550 R361E.15 EGFP-Rab32 was a gift from Marci Scidmore (Addgene plasmid # 49611); DV-GFP-Rab38-WT-pDEST53 was a gift from William Pavan (Addgene plasmid # 15669).23 pcDNA5 FRT/TO GFP-LRRK2 660-2527 was generously donated by Dr ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMRX-IP-GFP-LC3-RFP-LC3ΔG 15 a gift from Noboru Mizushima (Addgene plasmid # 84572; http://n2t.net/addgene:84572; RRID:Addgene_84572) and lenti-HA-mBec1 F121A 22 a gift from Congcong He (Addgene plasmid # 99506 ...
-
bioRxiv - Immunology 2023Quote: ... 15 ug pMDLg/pRRE (kind gift from Didier Trono (Addgene plasmid #12251; http://n2t.net/addgene:12251; RRID:Addgene_12251), and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Bioengineering 2023Quote: ... and 15 µg of pLVX-EF1a-GFP-LaminA-IRES-Hygromycin [37] (a gift from David Andrews; Addgene plasmid # 134867 ...
-
bioRxiv - Cell Biology 2024Quote: ... pEX-CMV-SP-YFP-STIM2(15-746) EF hand D80A was a gift from Tobias Meyer (Addgene plasmid # 18864 ...
-
bioRxiv - Neuroscience 2019Quote: ... promoter-driven AAV with mCitrine (n=44; U North Carolina vector core: AAV2-hSyn-HA-hM4D(Gi)-IRES-mCitrine) or mCherry (n=16; Addgene: AAV2-hSyn-hM4D(Gi)-mCherry ...
-
bioRxiv - Genetics 2021Quote: ... PiggyBac cargo plasmids used in Figure 3 and shown in Extended Data Figure 3 and pegRNA-expressing plasmids used in Figure 4 and Extended Data Figure 4 were created using the Mammalian Toolkit (Addgene article #2819751028), which was a gift from Hana El-Samad (UCSF).
-
bioRxiv - Neuroscience 2020Quote: ... These vectors are pCXLE- hOCT3/4-shp53-F (Addgene, Watertwon ...
-
bioRxiv - Cell Biology 2020Quote: ... A pMXs retroviral vector encoding human OCT3/4 (RRID:Addgene_17217), human SOX2 (RRID:Addgene_17218) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of pCMVR8.74 packaging vector (Addgene plasmid #22036) and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2019Quote: ... or pX330S-4 (Addgene #58780, deposited by Feng Zhang) according to the protocol available from Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene). Mice were also injected unilaterally in the mPFC (1.7 anterior-posterior (AP) ...
-
bioRxiv - Microbiology 2023Quote: ... described in(4) and obtained from Addgene (plasmid # 115809) to produce the HIV-1 LTR-eGFP virus ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-hDlx-GqDREADD-dTomato-Fishell-4 (Addgene, 83897-AAV9) viruses were injected in C57Bl6-Jax mice or in some cases in rats ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μg pCXLE-hOCT3/4-shP53 (Addgene #27077) and electroporated using the Neon System (Invitrogen ...
-
bioRxiv - Synthetic Biology 2023Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ...
-
bioRxiv - Molecular Biology 2019Quote: ... mCherry-SiT-N-15 plasmid was a gift from Michael Davidson (Addgene plasmid # 55133; http://n2t.net/addgene:55133;RRID:Addgene_55133). mCherry tagged GalT was generated from Cerulean-GalT plasmid by replacing cerulean to mCherry using subcloning technology ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-Clathrin LC-15 was a gift from Michael Davidson (Addgene plasmid # 55019; http://n2t.net/addgene:55019; RRID:Addgene_55019) (Rizzo et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... mEos4b-Clathrin-15 was a gift from Michael Davidson (Addgene plasmid #57506; http://n2t.net/addgene:57506; RRID:Addgene 57506). SV2A-mEos2 cloning was carried out by the Protein Expression Facility ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagRFP-T-Clathrin-15 was a gift from Michael Davidson (Addgene plasmid # 58005; http://n2t.net/addgene:58005; RRID:Addgene_58005) (Shaner et al ...
-
bioRxiv - Biophysics 2024Quote: ... and 15 µg lat-egfp-p2a-nfat-mcherry bicistronic gene in the MCSV backbone (similar to AddGene #91975) were pre-mixed in 1 mL of Opti-MEM media (Life Technologies Cat #:51985-034 ...
-
bioRxiv - Genomics 2020Quote: ... CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang[16]) or BbsI sites of pX459 (Addgene #62988 ...
-
bioRxiv - Neuroscience 2020Quote: [4] T2A-GCaMP6s from pGP-CMV-GCaMP6s (Addgene plasmid #40753) with T2A sequence includedintheforwardprimer(underlined ...
-
bioRxiv - Neuroscience 2020Quote: ... two unc-4 sgRNA plasmids and Cas9 plasmid (Addgene #46168) (Friedland et al. ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Immunology 2022Quote: ... Cells were transfected with 4 mg of SNAP-CD59 (Addgene) using Lipofectamine 3000 (Life Technologies) ...
-
bioRxiv - Genomics 2022Quote: ... 4 µg of the envelope-encoding plasmid pVSVg (Addgene 12260) and 7.5 µg of the packaging plasmid psPAX2 (Addgene 8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4 μg of envelope plasmid (pMD2.G; Addgene #12259) with 112 μg PEI MAX (Polysciences ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 µg of the viral packing PsPAX (Addgene #12260) plasmids using the Polyfect reagent according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... worms were grown on bacteria expressing double stranded RNA for him-8/klp-16 using the pLT 651 plasmid (Addgene plasmid # 59998, Timmons et al., 2014).
-
bioRxiv - Microbiology 2021Quote: ... 15 μg of pMDLg/p RRE and 10 μg of pRSV-Rev packaging plasmids (Addgene #12251 and Addgene #12253) and the pVSV envelope plasmid (Addgene #8454 ...
-
bioRxiv - Microbiology 2021Quote: ... 15 μg of pMDLg/p RRE and 10 μg of pRSV-Rev packaging plasmids (Addgene #12251 and Addgene #12253) and the pVSV envelope plasmid (Addgene #8454 ...
-
bioRxiv - Genomics 2020Quote: ... complete the Illumina sequencing primer sequences and add 15 bp of sequence homologous to the hSTARR-seq (Addgene #99292) plasmid for InFusion cloning ...
-
bioRxiv - Developmental Biology 2023Quote: ... viral lenti-particles were generated by transfecting HEK293 cells in a T25 flask with 15 μg of the lentiviral WβS-reporter vector (7TGC; Addgene #24304 ...
-
bioRxiv - Genomics 2024Quote: ... the 1 μg of total DNA was split in a 1:15 ratio of pCAG-NLS-Bxb1 (Addgene #51271) and recombination vector ...
-
bioRxiv - Developmental Biology 2021Quote: ... ACTB repair template AICSDP-15: ACTB-mEGFP was a gift from The Allen Institute for Cell Science (Addgene plasmid # 87425). SOX9 repair template was created by Infusion (638909 ...
-
bioRxiv - Neuroscience 2020Quote: ... viral vectors encoding DREADDs for ChI manipulation were infused into the NAcore of ChAT::cre animals: AAV5-hsyn-DIO-HM4D(Gi)-mCherry (inhibitory; titer: 1.2×1013 vg/mL; N=15 [Addgene, #44362]), AAV5-hsyn-DIO-rM3D(Gs)-mCherry (excitatory ...
-
bioRxiv - Molecular Biology 2020Quote: ... lentivirus was produced in HEK293FT cells transfected with NOCT Δ(2-15)-3F pCW57.1 and the pRSV-Rev (Addgene #12253), pMD2.G (Addgene #12259) ...
-
bioRxiv - Neuroscience 2021Quote: ... P14-15 WT and CYLD KO mice were anesthetized and injected with 0.2 μL AAV2-hSyn-EGFP (Addgene #50465-AAV2) into the CA1 hippocampus (AP ...
-
bioRxiv - Neuroscience 2023Quote: EnvA-enveloped ΔGL rabies viruses were rescued in 15 cm plates as described23 using genome plasmids pRVΔGL-4Flpo (Addgene 98040) and pRVΔGL-4Cre (Addgene 98039) ...
-
bioRxiv - Immunology 2023Quote: ... Stable transfection was performed by transfecting T2 cells with 4.5ug of HLA cDNA in the pSBbi-GP backbone and 0.5ug of pCMV(CAT)T7-SB100[15] (Addgene plasmid # 34879), followed by puromycin selection.
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral particles were produced in HEK293T cells by transfecting a 10 cm plate with 15 µg packaging plasmid psPAX2(Addgene), 5 µg envelope plasmid pMD2.G (Addgene) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 μg of the second-generation packaging plasmid psPAX2 (Addgene; 12260), and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: MEFs were transfected with 4 μg of 8xGTIIC-luciferase (Addgene, #34615), SBE2-luciferase (Addgene ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235). A His2Av polyA sequence after the BFP/Gal80 coding sequence was PCR amplified from pDEST-HemmarR2 (Addgene # 112813).
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-DIO-hM3-mCherry (4×1012 vg/ml, Addgene 44362), AAV8-hSyn-hM4-mCherry (6×1012 vg/ml ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235) using the oligonucleotides aaaaaaaaatcaaaATGAGCGGTACCGATTACAACAAAAGGAGTAGTGTGAG and GCCGACTGGCTTAGTTAattaattctagaTTAAAGCGAGTAGTGGGAGATGTTG ...