Labshake search
Citations for Addgene :
1 - 50 of 485 citations for Dl 4 Methoxyestradiol 13 14 15 16 17 18 13C6 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... AAV5 CaMKII-hM3Dq-IRES-mCitrine (3.75×10^14 or 3.75×10^13 virus molecules/mL) (Addgene plasmid #50466 ...
-
bioRxiv - Developmental Biology 2022Quote: NPC-iPS cells (clone 16-13(Maetzel et al., 2014)) were targeted with AAVS1-tdTomato (Addgene 159275) as described before(Ma et al. ...
-
bioRxiv - Molecular Biology 2022Quote: The sgRNAs of chromosome 15 and chromosome 17 were connected to the pX330-mCherry plasmid (Addgene, 98750). WT cells were transfected with 250□Jµl Opti-MEM that contained 5□Jµl Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA-FLAG-V5-Nsp10/14/16 vectors were constructed from pDONR223 SARS-CoV-2 Nsp10 (Cat. # 141264, Addgene), Nsp14 (Cat ...
-
bioRxiv - Neuroscience 2022Quote: ... 15° angle) and 0.5 μl of AAV5-hSyn-DIO-hM4D(Gi)-mCherry (2.4 × 10^13 GC/ml; Addgene) 26 or AAV5-hSyn-DIO-mCherry (2.3 × 10^13 GC/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... The (CGG)99 plasmid was obtained from Addgene and the (CTG)202 plasmid was a kind gift from Maurice Swanson ...
-
bioRxiv - Cancer Biology 2023Quote: ... SNAIL1 (Addgene #16225[18]) and SLUG (Addgene #25696 ...
-
bioRxiv - Neuroscience 2021Quote: ... Subset of pups were bilaterally injected with 4 μl AAV9-hsyn-EGFP (3.4×10^13 gc/ml, Addgene) or 4 μl ACh3.0 (1.8×10^13 gc/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... Pups were injected bilaterally with 4 ul of AAV9-hSyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene). Mice also received an injection of AAV9-hSyn-GRABACh3.0 to express the genetically encoded cholinergic sensor GRABACh3.0 48 ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-13:FBL-mEGFP (Addgene plasmid #87427 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 13S-A (Addgene #48323) for N-terminal TEV protease-cleavable His6-tag and tagless constructs ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... TadA8e (Addgene #138489)14 and Tad8.20m (Addgene #136300)50 were PCR amplified and inserted into empty entry vectors by Gibson assembly.
-
bioRxiv - Cell Biology 2021Quote: ... 18 µg psPAX2 packaging plasmid (Addgene#35002 ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-actin-C-18 (Addgene #53978), and mApple-paxillin-22 (Addgene #54935) ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Cell Biology 2019Quote: ... HA-14-3-3σ (11946, Addgene) was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024 ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Bioengineering 2020Quote: ... gifted from Isei Tanida [13] (Addgene plasmid # 61460), which were digested with PacI (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... 13 µg pCMVR8.74 (gift from Didier Trono, Addgene plasmid #22036 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 18 µg pMD2G envelope plasmid (Addgene#12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... and mCherry-MyosinIIB-N-18 (Addgene #55107) was achieved using a Nucleofector II electroporator and the Cell Line Nucleofector Kit V (Lonza Biosciences) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-mDia1-N-14 (Addgene plasmid #54157), mEmerald-mDia2-N-14 (Addgene plasmid #54159) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-mDia2-N-14 (Addgene plasmid #54159), and mRuby-LifeAct-7 (Addgene plasmid #54560 ...
-
bioRxiv - Microbiology 2021Quote: ... mEmerald-mDia1-N-14 (Addgene plasmid#54157), mEmerald-mDia2-N-14 (Addgene plasmid #54159) ...
-
bioRxiv - Microbiology 2021Quote: ... mEmerald-mDia2-N-14 (Addgene plasmid #54159), and mRuby-LifeAct-7 (Addgene plasmid#54560 ...
-
bioRxiv - Cell Biology 2023Quote: ... mEmerald-MyosinIIA-N-14 (Addgene plasmid #54191) and mApple-LC-myosin-C-10 (Addgene plasmid #54919 ...
-
bioRxiv - Microbiology 2022Quote: ... mEmerald-CLIP170-N-18 and mCherry-ATG3-C-18 were gifts from Michael Davidson (Addgene cat. 54967, 54044 and 54993) [63] ...
-
bioRxiv - Biochemistry 2022Quote: ... and co-transformation vector 13S-A (Addgene plasmid 48323), respectively ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV1-CAG-FLEX-GCaMP6f (RRID:Addgene_100835, titer 2.00E+13) for DAT-Cre or Anxa1-iCre mice) ...
-
bioRxiv - Cell Biology 2019Quote: ... or mEmerald-IFT88-N-18 (Addgene plasmid #54125). Cells were then selected with G418 and sorted based on their fluorescence ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 17 μg of plentiCas9-Blast (Addgene, Watertown, MA; #52962) by the calcium phosphate method ...
-
bioRxiv - Developmental Biology 2022Quote: The LARRY lentiviral barcoding library 17 was purchased from Addgene (https://www.addgene.org/pooled-library/camargo-plarry-egfp-barcoding-v1/) ...
-
bioRxiv - Genomics 2023Quote: ... 16 ug of plasmid were prepared for each plate at a ratio of 4:3:1 (sgRNA library: psPAX2(Addgene ID 12259): pMD2G(Addgene ID 12260)) ...
-
bioRxiv - Neuroscience 2022Quote: AAV1-CAG.FLEX.GFPsm_myc.WPRE.SV40 (1.12E+13 GC/ml) was purchased from Addgene. EnvA+ RVdG-5PSD95eGFP-SynPhRFP (1.55E+08 IU/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... target DNA sequence was cloned into 13S-R (Addgene # 48328). For testing the CRISPR interference in vivo ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald-Lamin A-C-18 (Addgene plasmid no. 54138) and mEmerald-Nucleus-7 (Addgene plasmid no ...
-
bioRxiv - Cell Biology 2023Quote: ... mVenus-Integrin-Beta1-N-18 plasmid (Addgene plasmid #56330) was obtained from Addgene (USA) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ElonginC (17–112) and ElonginB (1–104) (Addgene ID 204500 & 204501) were co-expressed in E ...
-
bioRxiv - Microbiology 2020Quote: The production of high titer Human sgRNA Brunello lentiviral library which contains 4 sgRNA per gene (15) (Addgene #73178), was performed by transfecting HEK293T cells in five 15 cm tissue culture plates using PEI (Polyethylenimin Linear ...
-
bioRxiv - Biochemistry 2021Quote: ... Sb#15 was amplified from pSb-init_Sb#15 (Addgene #153523) using the forward primer 5’-ATA TAT GCT CTT CAA GTC AGG TTC and the reverse primer 5’-TAT ATA GCT CTT CAA GAA CCG CCA CCG CCG CTA CCG CCA CCA CCT GCG CTC ACA GTC AC ...
-
bioRxiv - Biochemistry 2021Quote: ... Amplified gene drmB was cloned in plasmid 13S-S (Addgene: 48329), resulting in a N-terminal 6X His tagged to the protein product ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg MSCV CreERT2 puro (Addgene, 2276 ref (18)) and polybrene (8 µg/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... 18 μg of psPAX2 gag/pol packaging plasmid (Addgene 12260), and 12 μg of pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Genetics 2023Quote: ... for CTCF and mEmerald-RAD21-N-18 (Addgene Plasmid #54248) for RAD21 ...
-
bioRxiv - Developmental Biology 2023Quote: Transgenic animals were generated by injecting transgenes (15 ng μl-1 each) mixed with a co-injection marker pRF-4 (120 ng μl-1) (Addgene) expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Cell Biology 2020Quote: ... Blunt-end repaired RhoBAST16 was cloned into 5′ UTR CGG 99× FMR1-EGFP (Addgene, plasmid #63091) which was digested with the NotI enzyme ...
-
bioRxiv - Immunology 2019Quote: ... and pLTR-RD114A(13) (RD114) was a gift from Jakob Reiser (Addgene plasmid#17576 ...
-
bioRxiv - Neuroscience 2021Quote: ... including AAV5-hSyn-DIO-hM4DGi-mCherry (#44362, Addgene, 1.2x 10^13 titer), AAV5-hSyn-DIO-mCherry (#50459 ...