Labshake search
Citations for Addgene :
201 - 250 of 446 citations for DNA Standards since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... The fragment was subsequently cloned by DNA ligation in the donor vector pEN366 (Addgene #156432), after removal of the TRE3G-CTCF-mRuby2 fragment by digestion using the same restriction enzymes ...
-
bioRxiv - Neuroscience 2024Quote: ... 400ng or “filler DNA” expressing Gal4 (pPK-101) and 100ng of iCre plasmid (Addgene #116755). Nucleofection was performed using the EM-110 nucleofector program ...
-
bioRxiv - Cell Biology 2022Quote: ... and TAX1BP1 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GGGGCCACTAGGGACAGGAT) ...
-
bioRxiv - Genomics 2019Quote: ... monomeric streptavidin (mSA) DNA fragments amplified from PCS2+Cas9-mSA plasmid (Cat. 103882, Addgene, Watertown, MA) were inserted into the pY117 plasmid (pcDNA3.1-huMb3Cpf1 ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse YAP cDNAs were isolated by PCR amplification using DNA templates obtained from Addgene (Watertown, MA) and cloned into a shuttle vector at Creative-Biogene (Shirley ...
-
bioRxiv - Synthetic Biology 2021Quote: ... by combining a PCR-amplified FNLS-APOBEC1 DNA from pLenti-TRE3G-FNLS-PGK-Puro (Addgene# 110847), PCR-amplified Cas9n-NG DNA from pX330-SpCas9-NG (Addgene# 117919) ...
-
bioRxiv - Cell Biology 2020Quote: ... The HA-Dre DNA tile was designed based on pCAG-NLS-HA-Dre (Addgene Plasmid #51272).32 The CAG promoter was subcloned from pSF-CAG-Kan (OG505 ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA sequences for wildtype and R25C mutant of PHAKT from PH-Akt-GFP plasmid (#51465, Addgene) and PH-Akt(R25C)-GFP plasmid (#51466 ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Cancer Biology 2022Quote: ... a synthesized double-stranded DNA fragment from IDT and inserted into pENTR1A-GFP-N2 (Addgene # 19364) between EcoRI and NotI ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... and ligated into plasmid DNA containing the Cas9 enzyme and a puromycin resistance cassette (PX459, Addgene) followed by exonuclease treatment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the mCherry ORF was amplified from mCherry-H2A-10 (Addgene plasmid# 55054) by PCR using a forward primer harboring EcoR1 site (5’-TGACAGAATTCATGGTGAGCAAGG-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... and β-Actin DNA (Actin mRFP-PAGFP was a gift from Guillaume Charras & Tim Mitchison, RRID:Addgene_62382) into the third-generation lentiviral plasmid pCDH-EF1-IRES-Puro (System Biosciences).
-
bioRxiv - Genomics 2021Quote: ... DNA fragments were subsequently cloned into the STARR-seq screening vector (pSTARR-seq_human, Addgene plasmid #71509) using the In-Fusion® HD Cloning Kit (Takara/Clonetech) ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Cell Biology 2022Quote: ... cell cultures were transfected at 50% confluency with mEmerald-Tomm20-C-10 plasmid DNA (Addgene, 54281), and imaged one day after transfection ...
-
bioRxiv - Physiology 2022Quote: ... a DNA block containing sgEGFP-tRNA-Hnf4a-sg2 was PCR-amplified using pGTR plasmid (Addgene #63143) as a template and primers listed in Table S2 (see also Fig ...
-
bioRxiv - Molecular Biology 2022Quote: ... primers 1033F-1038F were individually mixed with primer 1039R and pLdCH plasmid DNA (Addgene #84291, (7)) to amplify an sgRNA expression cassette ...
-
bioRxiv - Molecular Biology 2022Quote: ... Template DNA for GluN2B (vector pCI-EGFP-NR2b) was provided by Andres Barria & Robert Malinow (RRID:Addgene_45447)(Barria & Malinow ...
-
bioRxiv - Neuroscience 2023Quote: ... The DNA plasmids consisted of: Cre recombinase under the Chicken β-actin (CAG) promoter (#13775, Addgene), Cre-dependent stGtACR2-FusionRed under the hSyn1 promoter (#105677 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Both guide sequences were then cloned as DNA inserts into pSpCas9 (BB)-2A-GFP (pX458) (Addgene plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA fragments containing MAP3K1 (MEKK1) or kinase-dead MAP3K1 were excised from pCDNA-MEKK1 plasmids (Addgene #12181 and #12180 ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting DNA was cloned into the pDR274 vector (Addgene, plasmid #42250; Hwang et al., 2013) following digestion of pDR274 with BsaI (R3733S ...
-
bioRxiv - Neuroscience 2021Quote: ... the DNA plasmids were respectively derived from the plasmids pAAV:EF1α:DIO:ChETA-eYFP (plasmid #26968; Addgene, Watertown, MA, USA) and pAAV:EF1α:DIO:eYFP (Addgene plasmid #27056 ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing GA50 was amplified from pAG303-Gal-GA50 (Addgene # 84907; (Jovičič et al., 2015)) and a DNA fragment containing GFP were inserted into pCAGEN by NEBuilder HiFi DNA Assembly Master Mix (NEB).
-
bioRxiv - Cell Biology 2022Quote: ... WT and FIP200 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GTCTTAGAAGCCGTGAGGTA for the NCOA4 gene ...
-
bioRxiv - Genomics 2020Quote: ... The resulting DNA fragments were cloned into the linearized STARR-seq vector (Addgene #71509, AgeI-SalI digested) using the In-Fusion HD kit (Takara) ...
-
bioRxiv - Cell Biology 2020Quote: ... plasmid as template DNA and primer ZU6_F1 and ZU6_Nanos3gRNA(NheI)_R with pDestTol2pA2-U6:gRNA (Addgene # 63157) plasmid as template DNA respectively.
-
bioRxiv - Neuroscience 2021Quote: ... WT and mutant forms of syt1 DNA were subcloned into a FUGW transfer plasmid (Addgene plasmid # 14883) modified with a synapsin promoter and an IRES-expressed soluble GFP marker ...
-
bioRxiv - Microbiology 2021Quote: ... marinum genomic DNA and cloned in-frame into the SspI site of 6XHis-MBP-TEV (AddGene: 29656). Plasmids were freshly transformed into the E ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting DNA fragment containing two MpU6promoter-gRNA cassettes was transferred into pMpGE010 (cat. no. 71536, Addgene) (Sugano et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... a FoxO1 plasmid encoding a deleted DNA binding domain (amino acid 208-220) was used (Addgene #10694). After 24 hours ...
-
bioRxiv - Neuroscience 2019Quote: ... the DNA cassette encoding KASH-tagged EGFP (EGFPKASH) (16) was amplified from the PX552 plasmid (Addgene #60958) by Phusion High-Fidelity DNA polymerase ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the synthesised DNA fragments were subcloned into the BbsI sites of the pX459 vector (#62988, Addgene). The resulting constructs were transfected into ES cells using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding heteronu-clear ribonucleoprotein A1 (hnRNPA1) was amplified from pET9d-hnRNP-A1 (#23026, Addgene) using PCR and inserted into mCherry-C1 (pmCherry-hnRNPA1) ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was performed using 1100 ng of total DNA (500 ng transfer plasmid, 500 ng pCMVR8.74 Addgene plasmid # 22036 ...
-
bioRxiv - Cancer Biology 2023Quote: ... EF.deltaBHES1.Ubc.GFP (DBD-HES1 DNA-binding domain mutant of HES1; #24982) were obtained from Addgene (Cambridge, USA). The reporter plasmids containing the firefly luciferase gene under the control of various fragments of the Hes1 promoter (2.5 kb ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA oligos containing guide RNA (gRNA) sequences were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene, #42230). The oligos were phosphorylated with T4 PNK (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lentiviral particles were generated by co-transfecting 1.5 µg of total DNA of pMDLg/pRRE (Addgene #12251), pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Bioengineering 2023Quote: ... The amplified gRNA plasmid DNA was co-transfected into HEK 293T cells with psPAX2 (Addgene, plasmid #12260) and pMD2.G (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: DNA fragments coding for full-length human Deltex1 (1863bps) was inserted into the pcDNA3.1-HA (Addgene #128034) mammalian expression vector with an N-terminal HA tag ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA sequences between nucleotides 1-3877 and 4236-4617 were PCR amplified from V5-GFP-P180 (Addgene #92150) and the two fragments were assembled and cloned into pEGFP(A206K)-N1 between XhoI and BamHI sites by GIBSON assembly ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... sequences to target the MYC gene in the proximity of the BR-coding region were designed using the online software CRISPR Design Tool (http://crispr.mit.edu/) and cloned as DNA inserts into pSpCas9 (BB)-2A-GFP (PX458) (Addgene plasmid # 48138 ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing HTT103Q-GFP was amplified from p426 103Q GPD (Addgene #1184; (Krobitsch and Lindquist, 2000)) and inserted into pCAGEN by NEBuilder HiFi DNA Assembly Master Mix (NEB).
-
bioRxiv - Genomics 2022Quote: ... Per transfection reaction we used 7.5ul of 1 mg/mL polyethyleneimine (PEI) and 2.325 μg of total plasmid DNA (825 ng psPAX2: Addgene #12260 ...
-
bioRxiv - Cell Biology 2019Quote: ... A DNA fragment encoding APEX2 was amplified from pcDNA3-APEX2-NES (gift from Alice Ting, Addgene plasmid # 49386) using primers GL3N2-APEX2 (5’-ggaggttctggtggtggtGCGGCCGCcGGAAAGTCTTACCCAACTGTGA-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... DNA oligos (IDT) containing sgRNA sequences were annealed and ligated into pX458 (Addgene, #48138, gift from Feng Zhang). Cells were transfected with pX458 constructs using Mirus TransIT-X2 (Mirus Bio ...
-
bioRxiv - Genomics 2021Quote: ... gRNA sequences were designed with chopchop (https://chopchop.cbu.uib.no) and corresponding DNA oligonucleotides containing BsmBI overhangs were annealed and ligated with lentiCRISPR v2 plasmid (Addgene, # 52961), which contains both Cas9 and sgRNA sequences55 ...