Labshake search
Citations for Addgene :
51 - 85 of 85 citations for Cytomegalovirus Purified Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... Male mice were injected intravenously with AAV8.mPcsk9D377Y (Addgene 58376, purified at Penn Vector Core)17 at a dose of 1012 viral genomes per mouse ...
-
bioRxiv - Genomics 2020Quote: ... using 0.1μl Tn5 stock solution (2.8mg/ml purified psfTn5-c006, Addgene plasmid #79107, in 50% Glycerol) previously loaded with standard Illumina Tn5 adapters in tagmentation buffer ...
-
bioRxiv - Genomics 2022Quote: ... Protein A-MNase was expressed and purified from BL21(DE) carrying pET-pA-MN (Addgene: 86973).68–70
-
bioRxiv - Molecular Biology 2024Quote: ... Purified ULP1 protease was added to the eluent overnight at 4°C (pFGET19_Ulp1, Addgene, Watertown, MA). The cleaved product was loaded onto a Ni column (Cytvia HisTrap™ High Performance ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were gel-purified and cloned into EcoRV-cut pLenti CMV Puro DEST (w118-1) (Addgene #17452 ...
-
bioRxiv - Biochemistry 2022Quote: ... cerevisiae eIF6A was purified essentially as described before (45) from the p7XC3GH (Addgene #47066; Watertown, MA, USA) plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... After PCR the insert was gel purified (GeneJet) and Gibson cloned into BsmBI-digested pXPR_053 (Addgene# 113591). Gibson cloned insert and vector was column purified (GeneJet ...
-
bioRxiv - Molecular Biology 2021Quote: ... 700ng/mL of proteinA-micrococcal nuclease (pA-Mnase purified in house with vector from Addgene 86973 79) were incubated with the nuclei at 4 degrees for an hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2500 ng of purified HDR PCR product and 1500 ng of guide RNA expression plasmid (Addgene 49330) containing the relevant guide RNAs (Supplementary Table 3 ...
-
bioRxiv - Biochemistry 2023Quote: ... The eHIV enzyme was expressed and purified from pET30-RT1306 (gift from Bryan Dickinson; Addgene plasmid # 131521) following published protocols (40).
-
bioRxiv - Genomics 2023Quote: ... sgRNAs were inserted into the BsmBI-digested and gel-purified CROPseq-Guide-Puro backbone (Addgene ID: 86708) with Gibson Assembly in the ratio of 2 ug sgRNA PCR product and 3 ug digested plasmid backbone ...
-
bioRxiv - Genetics 2020Quote: ... followed by incubation of annealed gRNA with 7 pmol of purified Cas9 (made after expression of Addgene #69090) [49] ...
-
bioRxiv - Biophysics 2019Quote: ... The enhanced activity SrtA pentamutant was expressed and purified from bacteria using the pET29-eSrtA vector (Addgene, #75144) as previously reported 31 ...
-
bioRxiv - Cell Biology 2020Quote: ... Fragments were purified by agarose gel electrophoresis and individually subcloned into BamHI/NotI-digested pBluescript II KS+ (Addgene). Colonies positive for the plasmid were selected on LB agar with 100 μg/ml ampicillin (Gibco from Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... the biRhoBASTn cassette was gel purified and ligated into XhoI-digested and dephosphorylated mAzurite-C1 (Addgene Plasmid #54583) to yield mAzurite-biRhoBASTn ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM TCEP) and digested with SUMO protease overnight (expressed and purified in-house from Addgene plasmid pCDB30243). The cleaved protein was dialyzed against Buffer D (25 mM HEPES ...
-
bioRxiv - Bioengineering 2023Quote: ... Homemade TEV protease (plasmid was obtained as a gift from David Waugh, Addgene #8827, and purified in-house)(44 ...
-
bioRxiv - Molecular Biology 2022Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
-
bioRxiv - Developmental Biology 2022Quote: ... the annealed products from CACCGGATTCACCTGGGGTCAACAC and AAAGTGTTGACCCCAGGTGAATCC were ligated to BsmBI linearized and purified lenti sgRNA_zeo backbone (Addgene 61427) to target proximal enhancer of CYP3A4.
-
bioRxiv - Immunology 2021Quote: ... A plasmid expressing SP140 was made by cloning the purified SP140 cDNA into the p3xFLAG-CMV-10 vector (Addgene) using Gateway techniques (Invitrogen) ...
-
bioRxiv - Biochemistry 2019Quote: ... in T-175 flasks were transfected at 80 % confluency with a transfection mixture consisting of purified plasmids of the pcS2+ vector (Addgene) containing human BBS2 with protein C peptide (HPC4 ...
-
bioRxiv - Neuroscience 2023Quote: ... University of Zurich (purified by VVF as v723-9; AAV9-hCMV-HA-SpCas9, Addgene 106431, gift from Juan Belmonte [22]).
-
bioRxiv - Biochemistry 2022Quote: ... The DNA fragments were purified and cloned into a pOPINJ vector (a kind gift from Ray Owens, Addgene plasmid 26045) to encode a 3C-cleavable His6-GST-fusion using In-Fusion enzyme (Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: Chromosomal DSB repair assays were performed using Cas9-gRNA RNP complexes assembled from Cas9 purified after overexpression in bacteria (Lin et al., 2014) (Addgene #69090), as well as annealed tracrRNA and target-specifying crRNA with stabilizing modifications (Alt-R ...
-
bioRxiv - Molecular Biology 2019Quote: ... The linear donor was generated by PCR and gel purified from a plasmid harboring a synthetic AID-P2A-Hygromycin insert (pMGS54, Addgene #126583). We amplified the insertion using primers that contain 50 nucleotide homology tails ...
-
bioRxiv - Biophysics 2019Quote: ... ZapA-LPETG was incubated with 0.5 mM of labelled peptide GGGC-Cy5 and 10μM Sortase 7M (purified using pET30b-7M SrtA, a gift from Hidde Ploegh, Addgene plasmid #51141) in a final concentration of 50 μM ...
-
bioRxiv - Cell Biology 2021Quote: ... The amplicon was then digested and ligated to the already digested and gel purified PB-TRE-dCas9-VPR plasmid (Addgene, 63800) backbone ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resin was washed 6 times with lysis buffer (supplemented with 100 nM USP2 (purified in-house from Addgene plasmid 36894) for de-ubiquitinated TOP2B) ...
-
bioRxiv - Molecular Biology 2021Quote: ... This plasmid was used as a template for PCR and 2500ng of purified HDR template PCR product combined with 1500ng of guide RNA expression plasmid (Addgene 49330) containing the guide RNA listed in Table S4 were co-transfected into OSCs ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... by high fidelity Q5 polymerase PCR using primer set given table-1 and cloned purified hACE2 gene fragment into NheI and BamHI digested fragment of pLenti backbone (Addgene, 112675) by Gibbson assembly ...
-
bioRxiv - Biochemistry 2022Quote: ... Immobilized proteins were eluted by incubation with 1 mL of 250 nM SENPEuB protease (expressed and purified from pAV286 (Addgene # 149333))74 overnight at 4° C ...
-
bioRxiv - Plant Biology 2021Quote: ... The amplicons were purified and assembled using the Golden Gate method (Weber et al., 2011) in the level 0 pICH41308 (Addgene no. 47998) destination vector for subsequent Golden Gate cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... AsCas12a/AsCpf1 protein was purified as described47 from an expression plasmid generated by deleting the MBP sequence from plasmid pDEST-hisMBP-AsCpf1-EC (Addgene plasmid # 79007) transformed into Rosetta(DE3)pLysS Competent Cells (Novagen) ...
-
bioRxiv - Bioengineering 2020Quote: ... The eluted fractions were then pooled together and underwent TEV cleavage overnight at 4°C (TEV protease was purified using the plasmid pRK793, #8827 from Addgene, a gift from David Waugh Lab).
-
bioRxiv - Cell Biology 2024Quote: ... HeLa cells transiently co-expressing individual GFP-tagged RUSH reporter and GalT-mCherry were cultured in complete DMEM supplemented with16 nM His-tagged streptavidin (in-house purified using Addgene #20860, a gift plasmid from A. Ting)(Howarth et al. ...