Labshake search
Citations for Addgene :
51 - 100 of 480 citations for Collagen Binding Fragment since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). PUF9R-tethered iRFP670 and mRuby2 were created by a combination of PCR (from IDT gBlocks ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reporter constructs contained 14 UAS sites for Gal4-DBD binding (source: Addgene 128010), an enhancer and a core promoter ...
-
bioRxiv - Genomics 2024Quote: Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). Cloning of dCas9 expression plasmid (lenti-dCas9-Blast ...
-
bioRxiv - Developmental Biology 2021Quote: ... These fragments were integrated into a PL552 vector (Addgene, #68407) that contained a floxed expression cassette of puromycin-resistant genes downstream of the pgk promoter and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... The SEP fragment with Gibson overhangs was amplified from Addgene plasmid pCI-SEP-GluR2(Q ...
-
bioRxiv - Bioengineering 2020Quote: ... and the blasticidin fragment amplified from lentiCas9-Blast (Addgene #52962). To establish a line of BE3-expressing cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the following fragments: an IRES sequence amplified from Addgene #102423 using primers CTTGACATGCTCCCCGGGTAACCCCTCTCCCTCCCCCCC and GCTCCATTCATTTATCATCGTGTTTTTCAAAGGAAAACCACG ...
-
bioRxiv - Developmental Biology 2022Quote: ... the ZFA fragment was subcloned into pMLM290 (Addgene, plasmid 21872), which includes a modified FokI nuclease domain [103] ...
-
bioRxiv - Cancer Biology 2022Quote: ... The BioID fragment was amplified from pcDNA3.1 mycBioID (Addgene: 35700) [10] and inserted into the pPBP-tet-3xEGFP after cutting at the KpnI and PmeI restriction enzyme sites ...
-
bioRxiv - Cell Biology 2022Quote: ... The resulting DNA fragment was cloned into pENTR1A vector (Addgene). Lentiviral construct was generated via recombination of pENTR1A-Breg into pLenti CMV/TO Puro DEST (Addgene) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... three fragments were cloned into the pUK21 backbone (Addgene #49787) which was digested using XhoI/XbaI to generate the intermediate plasmid pHA-white-dsRED ...
-
bioRxiv - Microbiology 2023Quote: ... The amplified fragments were then cloned into PlentiCMVPuro (Addgene, #17452) plasmids by Gibson assembly from NEB (#E2611L) ...
-
bioRxiv - Plant Biology 2023Quote: ... The resultant fragment was subcloned into pMpGWB304 (Addgene ID: 68632) (Ishizaki et al ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Synthesised DNA fragments were cloned into vector PGWB514 (Addgene 74856) (84 ...
-
bioRxiv - Cell Biology 2024Quote: ... hP53DD fragment was cloned into PEmax-P2A-hMLH1dn (Addgene #174828) at the C-terminus (hP53DD-PEmax-P2A-hMLH1dn ...
-
bioRxiv - Cell Biology 2024Quote: ... the BSD fragment in pCMV-PEmax-P2A-BSD (Addgene # 174821) was first replaced with the hP53DD fragment to generate pCMV-PEmax-hP53DD ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (wt p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442). The DNA polymerase used was Phusion High Fidelity (cat# E0553S ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following ORF24 fragments: residues 1-201 (ORF24-NTD) (Addgene #138420), residues 1-271 (Addgene #138421) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The recombined fragments were then inserted into pCAGEN vector (Addgene, 11179). To determine transcription initial site and BNLN localization ...
-
bioRxiv - Cancer Biology 2019Quote: ... Linear ZsGreen fragment was amplified from plasmid pLVX-shRNA-ZsGreen (Addgene) with primers ZsGreen E-F and ZsGreen B-R (Table S1) ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of mMff-P2A (a gift from David Chan (Addgene plasmid # 44601 ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of DIO-EGFP (a gift from Bernardo Sabatini (Addgene plasmid # 37084 ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of mDrp1-P2A (a gift from David Chan (Addgene plasmid # 34706 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The fused fragments were then inserted into pQCXIP vector (Addgene, 631516), by using NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... PRC1 fragment was amplified from His6-PRC1 plasmid (Addgene number: 69111) (Nixon et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... a DNA fragment of NLS–mRuby2 (obtained from Addgene plasmid 40260), was amplified and then cloned into the pENTR/D-TOPO vector (Invitrogen ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR fragments obtained from TurboID-containing plasmid (V5-TbID-NES_pCDNA3, Addgene) and pEarleyGate101 vector were assembled by overlapping ends using Gibson assembly master mix (NEB ...
-
bioRxiv - Cancer Biology 2019Quote: ... as an AgeI-FseI fragment and subcloned into pX459 (Addgene #62988) to replace the nuclease active Cas9 protein ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VPR fragment amplified from Addgene plasmid #78898 22 with primers 986.C11 and 986.C12 to generate plasmid OA-986B (Addgene #124999) ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VP64 fragment amplified from Addgene plasmid #78897 22 with primers 986.C17 and 986.C18 to generate plasmid OA-986D (Addgene #125001) ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VPR fragment amplified from Addgene plasmid #78898 22 with primers 986.C15 and 986.C12 to generate plasmid OA-986C (Addgene #125000) ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VP64 fragment amplified from Addgene plasmid #78897 22 with primers 986.C20 and 986.C18 to generate plasmid OA-986E (Addgene #125002).
-
bioRxiv - Developmental Biology 2022Quote: ... codon-optimized gBlock fragments into the pCW57.1 vector (Addgene plasmid #41393) downstream of the doxycycline-inducible promoter ...
-
bioRxiv - Plant Biology 2022Quote: ... two fragments from pGTR (gift from Yinong Yang, Addgene ID 63143) were amplified ...
-
bioRxiv - Neuroscience 2023Quote: ... Then postBirA* fragment and pAAV-FLEX-GFP vector (Addgene, Cat # 28304) were both digested with KpnI (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: Human Htt-exon1-Q94 fragment from pTreTight-Htt94Q-CFP (Addgene, #23966) was cloned into pBlueScript SK+ (kind gift of Eva Brinkman ...
-
bioRxiv - Cell Biology 2023Quote: ... The miRFP fragment was amplified from pmiRFP-N1 (Addgene Cat # 79987) by the primers Gib-miRFP-F (taagcttggtaccgagctcgATGGTAGCAGGTCATGCCTC ...
-
bioRxiv - Immunology 2023Quote: ... TThis fragment then was subcloned into a retroviral SFG.CNb30_opt.IRES.eGFP (Addgene, USA) at the NcoI and XhoI restriction sites ...
-
bioRxiv - Bioengineering 2023Quote: ... into a PCR-ed fragment of plasmid pBbA2c-RFP (Addgene #35326) to replace the red fluorescent protein (RFP ...
-
bioRxiv - Genetics 2023Quote: ... The mPGK-PuroR-bGHpA fragment was isolated from p2attPC (Addgene 51547) with the mCherry deleted by PCR ...
-
bioRxiv - Developmental Biology 2023Quote: ... the iTol2 flanked kanR-cryaa:sfGFP fragment was PCR amplified from Addgene #74153 (Fuentes et al. ...
-
bioRxiv - Genomics 2022Quote: ... and the previously digested hu6 PCR fragment (from pMJ117 Addgene 85997) with appropriate overhangs was inserted via T4 ligation ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The amplified fragment was ligated into the pCDNA3.4 vector (Addgene, USA) with a C-terminal 6×His-tag tag ...
-
bioRxiv - Cell Biology 2023Quote: ... The fragments were inserted into a pEGFP-C1 vector (Addgene 46956) using the PstI/BspEI restriction sites.
-
bioRxiv - Cell Biology 2023Quote: ... The fragments were inserted into a pEGFP-C1 vector (Addgene 46956) using the AgeI/BglII restriction sites.
-
bioRxiv - Cell Biology 2024Quote: ... Each fragment was then cloned into the pScarlet-N1 plasmid (RRID:Addgene_128060) from Oskar Laur ...
-
bioRxiv - Biochemistry 2021Quote: URA7 and URA8 wild type genes with ribosomal binding site were cloned into pet28b-6His (Addgene, Massachusetts ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Cell Biology 2023Quote: ... conjugated with the Rhotekin Rho Binding domain (RBD)-GST fusion protein (produced from Addgene plasmid #15247), for 1 hour at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... pIRES-H2B-AcGFP Plasmid was cloned by replacing mCherry fragment from Addgene plasmid 21044 with amplified AcGFP using Age1 and Not1 site ...