Labshake search
Citations for Addgene :
1 - 50 of 480 citations for Collagen Binding Fragment since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... The antigen-binding fragments (Fab) were cloned into pHLSec vector (Addgene, #99845) using AgeI and XhoI restriction sites ...
-
bioRxiv - Genetics 2022Quote: ... ALKBH5 fragments (Addgene, 134783) or dALKBH5 fragments (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... targeting LRRK2 sequence near GTP binding and ATP kinase binding domains were synthesized and cloned into pSpCas9(BB)-2A-GFP plasmid (Addgene #48138). Plasmids were transfected into A18945 iPSC line using Lipofectamine-Stem transfection reagent (ThermoFisher #STEM00001 ...
-
bioRxiv - Genetics 2022Quote: ... or dALKBH5 fragments (Addgene, 134784) and backbones (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FOP flash (mutated TCF binding sites; Addgene#12457) luciferase expression vectors and with Renilla luciferase vector (control ...
-
bioRxiv - Molecular Biology 2022Quote: PCR fragment with pY010 (Addgene #69982) as template and the following primers was cloned into pX458 (Addgene # 48138 ...
-
bioRxiv - Neuroscience 2023Quote: The loxpSTOPlox (LSL) fragment from Addgene #89587 was amplified with primers CAG-LSL-MreI-F and CAG-LSL-EcoRV-R ...
-
bioRxiv - Cell Biology 2023Quote: ... or MRE plasmid with mutated TCF binding sites (Addgene, 12457), together with 100 ng of the Renilla luciferase control plasmid (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Bioengineering 2021Quote: ... Fragments of PE2-encoding sequence (Addgene #132775) and NG-Cas9-encoding sequence (Addgene #124163 ...
-
bioRxiv - Genomics 2021Quote: ... gene fragment containing CTT pegRNA (Addgene #132778) was PCR amplified using primer sets adding 5-bp degenerate barcode and flanking BsmBI site for the downstream cloning steps ...
-
bioRxiv - Cancer Biology 2023Quote: ... the fragment was ligated into tRMPVIR (Addgene) plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... the fragment was ligated into pENTR2B (Addgene) and then recombined into pCW57.1 (Addgene) ...
-
bioRxiv - Genetics 2021Quote: ... This fragment was used to replace the NdeI/EcoRI fragment from pCMV-BE2 (Addgene#73020 (Komor et al., 2016)) digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... the promoter of the established TEAD binding reporter (8xGTIIC)(18) (Addgene, 34615) was fused into a construct containing destabilized GFP (Addgene ...
-
bioRxiv - Bioengineering 2020Quote: ... The BE3-blasticidin fragment was obtained by assembly of the BE3 fragment amplified from the pCMV-BE3 vector (Addgene #73021) and the blasticidin fragment amplified from lentiCas9-Blast (Addgene #52962) ...
-
bioRxiv - Cell Biology 2021Quote: ... by replacing a fragment of pDD282 (Addgene #66823) containing the GFP sequence with a similar fragment containing a codon optimized mCherry sequence with synthetic introns using the flanking Bsu36I and BglII restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: ... The SEC_3xFLAG_ccdB fragment was from pDD282 (Addgene #66823), except that the let-858 3’UTR was substituted by the par-5 3’UTR to prevent gene silencing in the germline ...
-
bioRxiv - Microbiology 2022Quote: ... PCR fragments amplified from pFLAG-attP (Addgene, #110095) with primers Apr fw/Apr rv and from pSEVA524 with primers tetA fw/tetA rv,25 respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... and opie2-dsRed marker fragment amplified from Addgene plasmid #100580 using primers 1010.C7 and 1010.C8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 with primers 1010.C5 and 1010.C6 ...
-
bioRxiv - Cell Biology 2020Quote: ... by replacing a fragment of pDD282 (Addgene #66823) comprising the GFP sequence with a similar fragment comprising a codon optimized and synthetic intron-containing eGFP sequence using the flanking Bsu36I and BglII restriction sites ...
-
bioRxiv - Biochemistry 2021Quote: ... Gene fragments were cloned into pNIC28-Bsa4 (Addgene #26103 ...
-
bioRxiv - Bioengineering 2020Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 19 with primers 986.C3 and 986.C4 ...
-
bioRxiv - Bioengineering 2020Quote: ... and an sgRNA scaffold fragment amplified from Addgene plasmid #49411 23 with primers 1045.C3 and 1045.C4 ...
-
bioRxiv - Cell Biology 2020Quote: ... A fragment spanning the pMSCV-hygro (Addgene, 634401) Hygromycin B resistance cassette was amplified by PCR (primer sequences available upon request ...
-
bioRxiv - Cell Biology 2023Quote: ... Resulting fragments and mCherry cDNA amplified from Addgene plasmid #102245 were assembled using Gibson Assembly ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... by high fidelity Q5 polymerase PCR using primer set given table-1 and cloned purified hACE2 gene fragment into NheI and BamHI digested fragment of pLenti backbone (Addgene, 112675) by Gibbson assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... mTurquoise2-2xFKBP’-Rac1Q61LΔCAAX was generated by ligating the larger fragment from EGFP-2xFKBP’-Rac1Q61LΔCAAX (Liu et al., 2014) with the smaller fragment from pmTurquoise2-N1 (Addgene Plasmid #60561), after digestion with BsrGI and NheI ...
-
bioRxiv - Neuroscience 2024Quote: pAAV CAG-FLEx-FLPo was constructed by in-fusion-based PCR cloning utilizing the following two DNA fragments: i) SalI-AscI restriction fragment of pAAV CAG-FLEx-TCb (Addgene #48332) as a vector backbone ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (WT p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442 ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected with either TOP flash (containing TCF binding sites; Addgene#12456) or FOP flash (mutated TCF binding sites ...
-
bioRxiv - Neuroscience 2022Quote: ... The gRNA binding sequence (AAGAGGTACGTACAGGTACT) was inserted into the vector pDD162 (from Addgene) using the NEB Q5 Site-Directed Mutagenesis Kit ...
-
bioRxiv - Physiology 2023Quote: ... with the carboxy tail fused to either the N-fragment (VN) or the C-fragment (VC) of the Venus protein (27097, 22011; Addgene, Cambridge, MA), auxiliary subunits CaVα2δ ...
-
bioRxiv - Cancer Biology 2019Quote: ... Linear Cas9-EGFP fragment was amplified from px458 (Addgene) with primers Cas9 SalI-F and Cas9 HindIII-R (Table S2) ...
-
bioRxiv - Immunology 2020Quote: ... and lambda fragments were cloned into AbVec2.0-IGHG1 (Addgene plasmid # 80795 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2A-EGFP fragment was cloned from pCAS9_GFP (Addgene #44719) and the FRT-PGK-Neo-FRT cassette was cloned from pZero-FRT-Neo3R (kindly provided by Dr ...
-
bioRxiv - Synthetic Biology 2019Quote: ... a plasmid encoding for a GFP1-10 fragment (Addgene #70219 ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 promoter fragment sequence amplified from Addgene plasmid #49411 23 with primers 1045.C1 and 1045.C2 ...
-
bioRxiv - Plant Biology 2022Quote: ... Xa4 fragments were subcloned into pUC57Gent vector (Addgene #54338)(Binder et al. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The full-length fragment of E2_pENTR_R4R3_T CTP (Addgene #171736) were amplified using primers with SV40NLS sequence added (NLS_E2_Fw/Rv) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2A-EGFP fragment was cloned from pCAS9_GFP (Addgene # 44719) and the FRT-PGK-Neo-FRT cassette was cloned from pZero-FRT-Neo3R (kindly provided by Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... A fragment with 24xMS2v7 repeats was obtained from Addgene plasmid #140705 and cloned downstream of the coding sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... A fragment containing 24xGCN4_v4 repeats was derived from Addgene plasmid #74928 ...
-
bioRxiv - Biochemistry 2023Quote: ... the DNA fragment encoding G6PD WT (Addgene plasmid #41521)56 with C-terminal 6×His tag was cloned into a pCDF vector ...
-
bioRxiv - Cell Biology 2023Quote: ... The mCherry fragment was amplified from pmCherry_a_tubulin_IRES_puro2 (#21043, Addgene) using the following primers ...
-
bioRxiv - Bioengineering 2023Quote: APEX2-OMM gene fragment (from a plasmid Addgene #238450) was cloned into a second generation 5’ self-inactivating lentiviral backbone (pHR ...
-
bioRxiv - Synthetic Biology 2024Quote: ... these three fragments and the pTU1 backbone (Addgene #72934) were ligated to form G363.
-
bioRxiv - Synthetic Biology 2021Quote: ... all TF binding site and mKate sequences were derived from SPECS plasmids (Addgene #127842). The NFAT response element was subcloned from the pSIRV-NFAT-eGFP plasmid68 (a gift from Peter Steinberger ...