Labshake search
Citations for Addgene :
201 - 250 of 315 citations for Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3G APOBEC3G Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... a BP reaction was performed with pDONR 221 and pMDC123SB-AtMIR390a-B/c28 (Addgene ID: 51775). pMDC123SB-AtMIR390a-B/c contains AtMIR390a 5’ end and AtMIR390a 3’ end which were split by Bsa I-flanking ccdB expression modules ...
-
bioRxiv - Microbiology 2021Quote: ... TBK1 and KHNYN genes were cloned into BsmBI restriction enzyme sites in the lentiviral CRISPR plasmid lentiCRISPRv2 (Addgene). LentiCRISPR VLPs were produced on HEK293T cells seeded on a 10cm dish ...
-
bioRxiv - Developmental Biology 2022Quote: ... plasmid DNA (5 ng/μl) and Tol2 transposase mRNA(4 ng/μl) (synthesized from pT3TS-Tol2 Addgene #31831) were injected into one-cell stage embryos ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Immunology 2020Quote: ... Constructs for MRTFA/B silencing and overexpression were gifts from Ron Prywes (Addgene # 27161, #19846, and #27175). To generate inducible expression constructs ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9-Ef1a-DO-hChR2(H134R)-mCherry (gift from B. Sabatini; Addgene plasmid 37082(Saunders et al., 2012); Vigene Biosciences ...
-
bioRxiv - Neuroscience 2023Quote: ... we generated pAAV-GFAP-GCaMP6m plasmid from flexed-GCaMP6 and pZac2.1-GfaABC1D-mCherry−hPMCA2w/b (Addgene, 111568) and used AAV2/9-pAAV-GFAPGCaMP6m at a concentration of 1.07527E+13 genome copies per ml (gc/ml) ...
-
bioRxiv - Molecular Biology 2022Quote: ... pT-mAppleT2Apuro(15.1kb) was generated by cloning a PacI/BamHI restriction enzyme fragment from pAdEasy-1 (Addgene, Plasmid#16400) into pT-mApple ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 100 ng/µl of Cas9 mRNA transcribed from the linearized MLM3613 plasmid (Addgene 42251; Dahlem et al., 2012). GFP-positive individuals were crossed to wildtype ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 pg membrane-mCherry mRNA (pCS-memb-mCherry was a gift from Sean Megason; Addgene plasmid # 53750; http://n2t.net/addgene:53750; RRID:Addgene_53750; 55) and unilaterally injected with 2.6-3.8 pmol of FOLR1-MO1 (FOLR1 KD ...
-
bioRxiv - Biochemistry 2021Quote: ... coli BL21(DE3) RIL from the pET-derived vector 14-B (a gift from S. Gradia; Addgene 48308) in LB medium individually ...
-
bioRxiv - Systems Biology 2020Quote: HEK293T cells were transfected with the combined A and B components of the GeCKO v2 (Addgene #1000000048, #1000000049) whole genome library (123,411 sgRNAs in total ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ; http://n2t.net/addgene:111568 ; RRID:Addgene_111568) with primers designed to incorporate a N-terminal HA tag encoding the amino acids YPYDVPDYA and used to replace mCherry-PMCA2w/b in the same backbone at the 5’ NheI and 3’ XbaI restriction sites using the NEBuilder Hifi DNA assembly kit ...
-
bioRxiv - Molecular Biology 2019Quote: ... HSP104-b/Leu(WT) was a gift from Susan Lindquist (Addgene plasmid # 1156; http://n2t.net/addgene:1156; RRID:Addgene_1156) (Schirmer et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... RBM39 wt and variants were cloned into the Artichoke reporter plasmid (a gift from B. Ebert, Addgene 73320) using Golden Gate cloning.
-
bioRxiv - Biochemistry 2023Quote: ... as described in Janecek et al.39 Aurora B protein was expressed from plasmid pNIC28-AurB (Addgene 39119).
-
bioRxiv - Plant Biology 2023Quote: ... as well as the B-module with mNeonGreen (amplified from an AddGene-derived template (Shaner et al., 2013)) and the C-module with LTI6b (amplified from total cellular A ...
-
bioRxiv - Cell Biology 2024Quote: B16-F1 cells were transiently transfected with CYRI-B-p17-GFP and mCherry-β1 integrin (Addgene plasmid #55064) and plated on laminin coated glass bottom dishes ...
-
bioRxiv - Biochemistry 2024Quote: ... It was cloned into 438-B vector (kind gift from Scott Gradia; Addgene plasmid # 55219; http://n2t.net/addgene:55219; RRID:Addgene_5521982) in frame with an N-terminal 6xHis tag followed by a TEV cleavage site ...
-
REEP4 is recruited to the inner nuclear membrane by ELYS and promotes nuclear pore complex formationbioRxiv - Cell Biology 2020Quote: ... The plasmid encoding the TurboID enzyme as well as Turbo-ID-NLS were obtained from Addgene (Branon et al., 2018). REEP4-TurboID-HA and REEP5-TurboID-HA constructs for the generation of inducible cell lines were generated by combining the sequences of REEP4 or REEP5 (from HA-REEP5 ...
-
bioRxiv - Genetics 2021Quote: ... The plasmid was cut by MfeI and XbaI restriction enzymes and the 320bp fragment was cloned into a PU6::sgRNA vector derived from Addgene plasmid #46169 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The SHH coding sequence was PCR amplified and cloned using BsmBI-NotI restriction enzymes from pOEM1 pCMV:hShh-pPH:vsvged was a gift from Elly Tanaka (Addgene plasmid # 111156). Plasmids used in this study have been deposited on ADDGENE.
-
bioRxiv - Cell Biology 2020Quote: ... line was generated by Tol2 transgenesis of 1.1 kb ins promoter (in-house plasmid, MluI restriction enzyme digested) driving expression of mCardinal (Addgene: 51311) cloned with Cold Fusion.
-
bioRxiv - Microbiology 2020Quote: ... The fragment containing hACE2-V5 was digested by the XbaI and Sall restriction enzymes from the hACE2 cDNA and was cloned into pLenti-GFP (Addgene) in place of green fluorescent protein (GFP) ...
-
bioRxiv - Cancer Biology 2022Quote: ... encoding human KDM6A with HA tag and pCS2-UTX-F-MT2 (40619) encoding enzyme-dead human KDM6A were purchased from Addgene. The HR and NHEJ reporter plasmids were kind gifts from Tomasz Skorski (61) ...
-
bioRxiv - Plant Biology 2020Quote: ... CAL1 coding region and a NOS terminator was excised using EcoRI and HindIII restriction enzymes and cloned into binary pTF101 vector (Paz et al., 2004; Addgene plasmid #134770 ...
-
bioRxiv - Neuroscience 2023Quote: ... encoding the Cre enzyme fused to the green fluorescent protein (GFP) under the control of the human synapsin promoter was obtained from Addgene (AAVrg.hSyn.HI.eGFP-Cre.WPRE.SV40 ...
-
bioRxiv - Neuroscience 2023Quote: ... and used in conjunction with a retrograde AAV encoding the Flpo enzyme under an EF1α promoter (AAVrg-EF1a-Flpo, Addgene plasmid # 55637 ...
-
bioRxiv - Neuroscience 2022Quote: These transposon vectors were propagated in DH5α competent cells and co-transfected along with a plasmid encoding the hyperactive enzyme SB 100x Transposase (Addgene 34879 ...
-
bioRxiv - Cell Biology 2023Quote: ... Bgl2 and Mfe1 restriction enzymes were used to remove the ESYT1 sequence from the EGFP-E-Syt1 vector (Addgene, 66830) and ligate the Atp2c2c-FLAG sequence amplified from the pcDNA3.1-SPCA2C-FLAG vector ...
-
bioRxiv - Cell Biology 2023Quote: ... Obtained pcDNA-Halo was further digested with HindIII/Bam-HI restriction enzymes and ligated with the NPM insert (obtained by PCR amplification from eGFP-NPM (17578 Addgene) with our primers 5’-CCCAAGCTTCCACCATGGAAGATTCGATGGACATGG-3’ and 5’-CGGGATCCAAGAGACTTCCTCCACTGCC-3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... The lentiviral vector lentiCRISPRv2 carrying both Cas9 enzyme and a gRNA transfected into HEK293T cells together with the packaging plasmids psPAX2 and pCMV-VSV-G (Addgene) at the ratio of 5:3:2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... yap1 single mutant and yap1/yap1b double mutant siblings were injected at onecell stage with H2B-GFP mRNA (Addgene, #53744) at a final concentration of 25 ng/μL ...
-
bioRxiv - Developmental Biology 2021Quote: ... for the preparation of Cas9-mSA mRNA: the pCS2+Cas9-mSA plasmid was a gift from Janet Rossant (Addgene #103882) (Gu et al. ...
-
Enhancer Remodeling Promotes Tumor-Initiating Activity in NRF2-Activated Non-Small Cell Lung CancersbioRxiv - Cancer Biology 2020Quote: ... Lentiviral vectors expressing these gRNAs together with Cas9 mRNA were constructed by inserting annealed oligoDNAs (Extended Table S4) into LentiCRISPRv2 (Addgene). H460 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1128 base pairs of HyNotch-NICD (1648-2775 of Notch mRNA) was inserted into the vector pHyVec11 (Addgene plasmid #34794) and was driven by the Hydra actin promoter ...
-
bioRxiv - Cell Biology 2019Quote: ... DNA inserts were cut out from the TA-cloning constructs using restriction enzymes (BglII/XhoI for EhPKDL and BS1) and were subsequently cloned into (BamHI/XhoI) double digested expression vector pL4440 (Addgene, USA) which is flanked by T7 promoters at both ends ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR product was digested with EcoRI and BamHI restriction enzymes and sub-cloned into EcoRI/BamHI-digested pEGFP-C1 plasmid (Addgene #2487).
-
bioRxiv - Developmental Biology 2022Quote: ... The H2B-miRFP670 fragment was digested with the Cpol (Rsrll) and Klfl enzymes and inserted upstream of the Hygromycin resistance gene cassette of the ES-FUCCI plasmid (Addgene #62451). RAF-ERT2 (Hamilton and Brickman 2014 ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The catalytically active domains of JARID1A enzyme (1-797 amino acids) was amplified from pcDNA3/HA-FLAG-RBP2 plasmid (Addgene #14800), a gift from William Kaelin (Klose et al ...
-
bioRxiv - Cell Biology 2022Quote: ... the specific sgRNA was subcloned using BstXI and BlpI restriction enzymes into pU6-sgRN EF1Alpha-puro-T2A-BFP vector (Addgene #60955)24 ...
-
bioRxiv - Molecular Biology 2023Quote: ... were individually cloned into pRSFDuet-1 using the BamHI and HindIII restriction enzyme sites to generate pRSFDuet-1 IntS6 AA 1035-1284 (Addgene #196904) and pRSFDuet-1 IntS8 AA 1-308 (Addgene #196905) ...
-
bioRxiv - Molecular Biology 2023Quote: ... was cloned into pRSFDuet-1 using the SalI and HindIII restriction enzyme sites to generate pRSFDuet-1 IntS11 AA 300-597 (Addgene #199329). Details of cloning ...
-
bioRxiv - Neuroscience 2023Quote: ... pET22b-6h-GST-TEVp was digested with BamHI and XhoI restriction enzymes in order to remove TEVp gene (Addgene plasmid #172887). α-synuclein was cloned into pET22b-6h-GST backbone by Gibson assembly method ...
-
bioRxiv - Neuroscience 2023Quote: ... was achieved through the bilateral stereotaxic injection of an Adeno-Associated virus containing a cre-recombinase enzyme (AAVpmSyn1-EBFP-Cre, Addgene#51507) into the OB of Ghsrfl/fl∷Ai14 RFP (designated OBGHSR−/− ...
-
bioRxiv - Biochemistry 2023Quote: The pET28-eGFP-SLAP was digested with BamHI and XhoI restriction enzymes and the SLAPTAG-containing band was subcloned into SARS-CoV-2 S HexaPro plasmid (Addgene#154754) with the same restriction sites.
-
bioRxiv - Cell Biology 2022Quote: ... digesting the PCR generated fragment with HindIII and BamHI restriction enzymes and finally cloning it into the ptdTomato-C1 vector (Addgene, #54653), previously digested with HindIII and BamHI restriction enzymes.
-
bioRxiv - Biophysics 2023Quote: ... The gene fragment was excised using BstXI and XhoI restriction enzymes and then subcloned into similarly digested pmNeonGreen-DEVD-NLuc (Addgene: 98287)65 plasmid DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... and cloned using a BbsI restriction enzyme digested vector according to the method mentioned by the Feng Zhang lab at the MIT in Addgene (Addgene #62988)42 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and firefly luciferase control (FLuc) were generated by subcloning FLuc-5Xbox b from plasmid pAc5.1C-Fluc-STOP-5boxb (Addgene) into pcDNA3.1(+ ...