Labshake search
Citations for Addgene :
1 - 50 of 315 citations for Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3G APOBEC3G Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... sapiens SUV39H2 catalytic subunit (Addgene plasmid #25115) Escherichia coli expression plasmids used in this study were acquired from Addgene ...
-
bioRxiv - Biochemistry 2023Quote: The Homo sapiens EHMT1 catalytic subunit (Addgene plasmid #51314) and H ...
-
bioRxiv - Biochemistry 2019Quote: ... with Protein kinase A (M. musculus PKA catalytic subunit alpha; Addgene 14921) expressed with an N-terminal His tag ...
-
bioRxiv - Cell Biology 2019Quote: ... Histidine-tagged PKA catalytic subunit (a gift from Susan Taylor, Addgene plasmid #14921) and PKI3 were previously described ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid encoding EGFP-tagged PP1 catalytic subunit γ was obtained from Addgene (Addgene plasmid # 44225). Expression of PTSN was silenced in U2-OS and 293A cells by lentiviral transduction of a pLKO1 shRNA against both β- and α-PTSN (TRCN0000282572 ...
-
bioRxiv - Cell Biology 2019Quote: ... pLKO.3G (Addgene) was a gift from Christophe Benoist & Diane Mathis (Addgene plasmid # 14748 ...
-
bioRxiv - Microbiology 2022Quote: ... cells were immortalised using the catalytic subunit of hTERT delivered by transduction using a lentivirus vector (pLV-hTERT-IRES-Hygro; Addgene). Two days post-transduction ...
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Genetics 2019Quote: ... catalytic active lipin 1 (Addgene #32007), pRK5 FLAG wildtype ...
-
bioRxiv - Molecular Biology 2022Quote: Adenine base editing (ABE) and prime editing (PE) experiments were performed with pCMV_ABEmax73 (Addgene 112095), ABE8e74 (Addgene 138489) ...
-
bioRxiv - Neuroscience 2021Quote: ... pLKO.3G was a gift from Christophe Benoist & Diane Mathis (Addgene plasmid # 14748 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Various CRISPEY gene editing plasmids are available from AddGene.
-
bioRxiv - Cell Biology 2024Quote: ... 7.5 μg pCMV_AncBE4max_P2A_GFP plasmid (for base-editing, Addgene #112100) or pCAS9- mCherry-Frame +1 plasmid (for conventional CRISPR-Cas9 ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... For editing of CD163 a dual guide RNA lentivirus (Addgene #67974) was modified to express the CD163 guides SL26 and SL2855 by cloning a gBlock containing the crRNASL26-tracrRNA-mU6-crRNASL28 sequence into the BbsI site ...
-
bioRxiv - Molecular Biology 2023Quote: ... the genome editing one vector system (PX459) (104142, Addgene, MA, USA) was used ...
-
bioRxiv - Immunology 2021Quote: ... were subcloned into the lentiviral pLKO.3G vector containing an eGFP cassette (Addgene #14748), by transferring the BamHI-NdeI restriction fragments containing the shRNAs ...
-
bioRxiv - Cell Biology 2020Quote: CRISPR/Cas9-based genome editing was performed using LentiCRISPRv2-puro (Addgene #52961) or LentiCRISPRv2-blasti 9 using the following guide sequences as previously described38 ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used the gene editing crispr-cas9 system (lentiCRISPR-v2) (Addgene #52961). sgRNAs were designed using the CRISPR tool (http://crispr.mit.edu ...
-
bioRxiv - Molecular Biology 2023Quote: ... The SunTag/TET epigenome editing construct was obtained from Addgene (Plasmid #82559). Individual clones that were Geneticin® (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... Nicking sgRNA for PE3 editing was cloned into LsgRNA backbone (Addgene #47108) through BbsI site or into lenti-sgRNA blast (Addgene #104993 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Cancer Biology 2019Quote: ... mutant PI3K p110α subunit (pMIG-PI3KE545K, Addgene); Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPR-PE containing the blasticidin resistance gene ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression plasmids for WT and catalytic mutant mouse Lipin-1 were obtained from Addgene. Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... and TET1 catalytic inactive mutant (TET1CDmut) were amplified from FH-TET1-pEF (Addgene #49792) or pIRES-hrGFP II-mTET1 (Addgene #83569) ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Neuroscience 2020Quote: ... the following 21-mer shRNA inserts were cloned separately in the pLKO.3G vector (Addgene plasmid #14748): scrambled shRNA (CCTAAGGTTAAGTCGCCCTCG) ...
-
bioRxiv - Microbiology 2020Quote: The CRISPR-Cas12a (Cpf1) genome editing tool together with the pSL2680 plasmid (Addgene No. 85581) was used for the construction of Anabaena mutants ...
-
bioRxiv - Molecular Biology 2023Quote: ... was used for adenine base editing and pCMV-T7-SpCas9-P2A-EGFP (Addgene no. 13998724) for Cas9 editing ...
-
bioRxiv - Biochemistry 2021Quote: A pET28a plasmid containing the SENP2 catalytic domain (cat.SENP2) was obtained from Addgene (Catalog number 16357).44 The protein was expressed and purified from E ...
-
bioRxiv - Neuroscience 2021Quote: ... pLKO.3G was a gift from Christophe Benoist & Diane Mathis (Addgene plasmid # 14748; http://n2t.net/addgene:14748; RRID:Addgene_14748) and pCLX-UBI-VenusN was a gift from Patrick Salmon (Addgene plasmid # 27247 ...
-
bioRxiv - Cancer Biology 2022Quote: CD73 gene-editing was generated by electroporation of all-in-one CRISPR/Cas9 vector (px330, Addgene) expressing the 20mer target sequence GCAGCACGTTGGGTTCGGCG (exon1) ...
-
bioRxiv - Developmental Biology 2023Quote: The constructs for epigenome editing were based on the plasmid pSpCas9n(BB)-2A-GFP (Addgene #48140) (Ran et al. ...
-
bioRxiv - Cancer Biology 2023Quote: Knockout (KO) of Cdh1 was performed by CRISPR/Cas9 genome editing using pLentiCRISPRv2 (Addgene plasmid #52961) according to Zhang laboratory’s protocol (Ran et al. ...
-
bioRxiv - Genetics 2023Quote: Prime editing experiments in K562 and Jurkat cell lines were performed with pCMV-PEmax (Addgene 174820). The ATP1A1-Q118R_v2 epegRNA11 was cloned into pU6-tevopreq1-GG-acceptor (Addgene 174038 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Prime editing (PE) experiments were performed with pCMV-PEmax73 (a gift from David Liu; Addgene 174820), and pU6-tevopreq1-GG-acceptor39 (a gift from David Liu ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmid based prime editing: 500 ng pCMV-PE2-GFP (a gift from David Liu, Addgene#132776)115 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The editing cassette (Table S7) was amplified from pKAW066 (Figure S4, Table S2, Addgene ID 217968) using the manufacturer’s protocol for NEB Q5 Hot Start DNA Polymerase (M0494L ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid expressing the catalytic domain of PKCδ was previously described (Soh and Weinstein, 2003) (Addgene plasmid #16388).
-
bioRxiv - Cell Biology 2023Quote: ... and ATP10B variants (O94823.2, WT, RRID: Addgene_203695; catalytic mutations E210A and D433N, RRIDs: Addgene_203697 and Addgene_ 203696); and pathogenic variants R153X ...
-
bioRxiv - Cell Biology 2023Quote: ... and ATP10B variants (O94823.2, WT, RRID: Addgene_203695; catalytic mutations E210A and D433N, RRIDs: Addgene_203697 and Addgene_ 203696); and pathogenic variants R153X ...
-
bioRxiv - Microbiology 2020Quote: The plasmids used for CRISPR-Cas9 gene editing were pSpCas9(BB)-2A-GFP (PX458, Addgene ID 48138) and pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Genomics 2023Quote: ... CRISPR/Cas9 nickase gene editing was performed using vector pX335-U6-Chimeric BB-CBh-hSpCas9n(D10A) (Addgene) modified by standard restriction enzyme cloning (BbsI ...
-
bioRxiv - Developmental Biology 2022Quote: ... or synthesized (NLS and N1ICD the fragment of [ENSMUST00000028288.5] encoding the C-terminal 789 AA of the Notch1 protein) and cloned with sequence encoding an N- or C-terminal eGFP into a modified version of pLKO.3G (Addgene, Cat #14748 ...
-
bioRxiv - Genomics 2019Quote: ... The sgRNA expression vector for editing was based on plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene Plasmid # 42230), containing two BpiI restriction sites for inserting guide sequences into the sgRNAs ...
-
bioRxiv - Cell Biology 2022Quote: INCENP kinetochore recruitment by rapamycin addition was achieved by editing a previously described system (plasmid pERB109, Addgene number58280) (31) ...
-
bioRxiv - Molecular Biology 2023Quote: The construct for CRISPR/Cas9 genome editing of Cdr1as splicing sites is based on lentiCRISPRv2 (Addgene plasmid 52961), following the Zhang Lab protocol (39 ...
-
bioRxiv - Immunology 2021Quote: ... Lentiviruses were produced into HEK293T cells by using the calcium phosphate co-transfection method for each specific subcloned lentiviral pLKO.3G vector with the packaging plasmids gag/pol (Addgene #14887) and VSV-G (Addgene #14888) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and its cognate transactivator protein (3G) gene (derived from AAVS1_Puro_Tet3G_3xFLAG_Twin_Strep, a gift from Yannick Doyon: Addgene plasmid #92099; Dalvai et al., 2015). The resulting plasmid was named as DOGGp in this work ...
-
bioRxiv - Developmental Biology 2023Quote: ... The coding sequence of the catalytic domain of human KDM6B (1025–1680 aa) was obtained from the MSCV_JMJD3 plasmid (Addgene #21212) (Sen et al. ...