Labshake search
Citations for Addgene :
351 - 400 of 2832 citations for 7 Quinolinamine 1 2 3 4 tetrahydro 1 methyl hydrochloride 1 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV rtTA3 Blast (w756-1) and pLenti CMVTRE3G eGFP Neo (w821-1) were gifts from Eric Campeau (Addgene plasmids #26429 and #27569; RRIDs: Addgene_26429 and Addgene_27569). BCL2L1 (Bcl-xL ...
-
bioRxiv - Biochemistry 2022Quote: The control pLKO.1-LUC shRNA vector and the pLKO.1-FLCN lentiviral shRNA vector were obtained respectively from Addgene (Plasmid #30324) and the RNAi Consortium (TRCN0000237886) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Neuroscience 2020Quote: For the control rabies virus experiments VIPCre pups aged P15 were injected with 100nl of a 1:1 mix of pAAV-hSyn-FLEX-TVA-P2A-EGFP-2A-oG (gift from John Naughton, Addgene plasmid # 85225) and rabies virus (see above) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: After co-transfection for 36 hours with plasmid DNA encoding the relevant SNAP-tagged receptor (1 μg) and AKAR4-NES (1 μg; a gift from Dr Jin Zhang, Addgene plasmid #647270), wild-type or dual β-arrestin knockout HEK293 cells were suspended in HBSS in black 96 well plates ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmids pRSFDuet-1 His6-SUMO-CoiA1_CoiB and pETDuet-1 Coi_CoiSA(ED) (Addgene ID #208761 and #208762), following the method previously reported.10 For the preparation of methyllanthionine standard ...
-
bioRxiv - Neuroscience 2023Quote: ... 1000 nL of AAV5-CaMKIIa-GCaMP6f was injected into mPFC (diluted 1:1 in DPBS; Addgene, 100834-AAV5, 2.2e12 VG/mL titer). A 1-mm diameter GRIN lens (Inscopix ...
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA against β-catenin was purchased from Addgene (pLKO.1 puro shβ-catenin; Addgene cat no.18803). Scramble siRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used pXL002-ishRNA-beta-catenin-1 (Addgene, #36297) and pXL004-ishRNA-scramble (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... pLKO.1 neo was provided by Sheila Stewart (Addgene plasmid # 13425 ...
-
bioRxiv - Immunology 2021Quote: Human SHP-1 wt cDNA was obtained from Addgene. The cDNA of SHP-1 was subcloned into the expression vector pEYFP-N1(Clontech ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 1-K44A-mRFP was purchased from Addgene (#55795). Dynamin 2-mTFP1 (or dynamin 1-mTFP1 ...
-
bioRxiv - Neuroscience 2019Quote: ... The following plasmids were obtained from Addgene (Table 1). Striatal neuronal cells seeded in 35 mm glass bottom dishes or other plates were transfected 24 h later with cDNA constructs using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: The shRNA/pLOK.1 targeting rictor (plasmid #1853, Addgene) and the control scrambled shRNA (plasmid #1864 ...
-
bioRxiv - Cancer Biology 2019Quote: ... pLenti CMV Neo DEST (705-1) (Addgene plasmid # 17392) and pLenti CMV Puro (w118-1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and pLenti CMV Puro (w118-1) (Addgene plasmid # 17452) were gifts from Eric Campeau and Paul Kaufman30 ...
-
bioRxiv - Developmental Biology 2021Quote: 1 µg of R26P-M2rtTA targeting vector (Addgene, 47381) and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... and pMA122 (peel-1 negative selection; plasmid 34873; Addgene) into unc-119(ed3 ...
-
bioRxiv - Cancer Biology 2021Quote: A modified pLKO.1 lentiviral vector (Addgene plasmid #27994), in which the puromycin marker gene was replaced by eGFP (for knockdown experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... A mixture with 1 µg VSV-G (Addgene, 8454), 1 µg psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids used: pLKO.1 - TRC cloning vector (Addgene, # 10878)42 ...
-
bioRxiv - Biophysics 2020Quote: ... coli is pJCSUP35NM (1-253) (Addgene Plasmid number #1089). The over-expression of Sup35NM was induced using 1 M IPTG ...
-
bioRxiv - Genetics 2022Quote: ... and 1 µg VSV-G envelope plasmid (Addgene #8454) using 100 µL PEI in 1 mL serum-free DMEM and incubated at room temperature for 10 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Microbiology 2021Quote: ... PLKO.1 TRC cloning vector was purchased from Addgene (gift from David Root ...
-
bioRxiv - Neuroscience 2020Quote: ... We injected 1 µl of AAV1 Syn::GCaMP6s (Addgene) at a titer of 1x1013 vg/mL in the auditory cortex of wild-type mice ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 μl of AAV-CaMKIIa-eGFP (Addgene, #50469-AAV5) virus was injected bilaterally using a 10 μl nanofil syringe (World Precision Instruments ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 and pWPXLd plasmids were purchased from Addgene. shRNAs against Trp53 ...
-
bioRxiv - Physiology 2021Quote: ... the pLKO.1 cloning plasmid was obtained from Addgene, USA (Cat ...
-
bioRxiv - Biochemistry 2021Quote: ... pCMV6-XL4 ASXL1 (1-479) 3x FLAG (Addgene # 74262) were a gift from Anjana Rao ...
-
bioRxiv - Immunology 2021Quote: ... and HIV-1- gag-pol helper plasmid (pspax2, Addgene) using Lipofectamine 3000 according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and AdEasier-1 cells (#16399) were purchased from Addgene. Full length Rela gene was inserted into pShuttle-CMV with SalI and NotI to obtain pShuttle-CMV-Rela ...
-
bioRxiv - Cell Biology 2021Quote: The pLKO.1-Puro plasmid was purchased from Addgene. Small hairpin RNAs were cloned for generation of knockdown constructs (shRNAs ...
-
bioRxiv - Neuroscience 2023Quote: We used the pLKO.1 vector (Addgene plasmid 10878)7 for expression of shRNA against rat Sirt3 (target ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere; Addgene). During the same surgery ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hsyn-jGCaMP8m-WPRE (Addgene, 2.0E13 GC/ml)