Labshake search
Citations for Addgene :
601 - 650 of 2832 citations for 7 Quinolinamine 1 2 3 4 tetrahydro 1 methyl hydrochloride 1 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... specifically the pLenti PGK Blast V5-LUC (w528-1) plasmid (Addgene #19166). The process involved using SalI-HF (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... or pCAS9- mCherry-Frame +1 plasmid (for conventional CRISPR-Cas9, Addgene #66940), together with 10 μg PiggyBac transposon system (5 μg transposase + 5 μg hygromycin resistance containing transposon)8 were co-electroporated into human duodenum ...
-
bioRxiv - Cancer Biology 2023Quote: ... expressing Tp53 sgRNA (CCTCGAGCTCCCTCTGAGCC) and the pLKO.1-Hygro (Addgene Plasmid #24150) expressing Nf1 sgRNA (GTTGTGCTCGGTGCTGACTT) ...
-
bioRxiv - Cancer Biology 2024Quote: ... S1 Table) were annealed and cloned into the pLKO.1 vector (RRID:Addgene_8453) (29 ...
-
bioRxiv - Biochemistry 2024Quote: ... and pGEX-6P-1-INTS3-FL were gifts from Yuliang Wu (Addgene plasmids #128307 ...
-
bioRxiv - Biophysics 2024Quote: ... The transfer vector consisted of a modified pLKO.1 neo plasmid (Addgene) with expression of the shRNA sequences under control of 3× copies of the lac operator ...
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2019Quote: ... CDC45: guide#1 GCATCAGGGTCGGGCTCTGA and guide#2 GCTCTGTCCTCCCTCAACGG) were inserted into pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene plasmid #42335, a gift from Feng Zhang) via BbsI restriction site ...
-
bioRxiv - Neuroscience 2023Quote: 750 nl of rAAV.EF1a.DIO.hChR2(H134R).eYFP or rAAV.EF1a.DIO.eYFP (3-4 x 10^12 vg/ml, AAV5, University of North Carolina Vector Core; 1-2 x 10^13 vg/ml, AAV1, Addgene, 27056-AAV1 and 20298-AAV1) were injected into each hemisphere of the VTA of 3–4-month-old DAT-Cre mice ...
-
bioRxiv - Molecular Biology 2022Quote: pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1-shCltc1/ shCltc2/ shCltc3 were individually cotransfected with psPAX2 (ADDGENE NO. 12260), pMD2.G (ADDGENE NO ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3.1-GFP(1-10) was a gift from Bo Huang (Addgene plasmid # 70219). 2PH-PLCdelta-GFP was a gift from Sergio Grinstein (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478) and pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453). Lentivirus was generated as described previously (Ferraiuolo et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... High titer (>1012GC/ml) AAV2/1-hSyn-Cre-WPREhGH virus (Addgene 105553-AAV1) was diluted 1:8 or 1:4 in 0.9% saline and 1µl was injected under the forepaw skin ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Rab1060 was obtained from Addgene (#49472) and pET17b-Kif5b(1-560)-GFP-His61 was obtained from Addgene (#15219).
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid pCMV delta R8.2 encoding HIV-1 GagPol (Addgene, plasmid #12263) using Fugene 6 (Promega ...
-
bioRxiv - Genomics 2020Quote: ... EF06R (5’UTR-LINE-1) was a gift from Eline Luning Prak (Addgene plasmid # 42940 ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV9-CaMKIIα-hChR2(E123A)-EYFP (titer: 1×1013 viral genomes/mL; Addgene: 35505); GAD1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nontargeting shRNA pLKO.1-blast-SCRAMBLE was obtained from Addgene (Catalog #26701). Two shRNAs for each target were obtained and stable lentiviral transductions with the targeted shRNAs and the scramble control were performed ...
-
bioRxiv - Cell Biology 2021Quote: ... The Lentiviral backbone transfer plasmid p-lentiCRISPR - EGFP sgRNA 1 (Addgene Cat #51760) was used to express human codon-optimized Cas9 protein ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were transfected with GFP-swiprosin-1 and GBP-Apex (Addgene plasmid 67651) constructs using a Neon transfection system (as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... or the p53 targeting shRNA (shp53 pLKO.1 puro shRNA (Addgene ID: 19119) (36) ...
-
bioRxiv - Microbiology 2022Quote: THP-1 cells were transduced with lentivirus packaged with pLentiCas9-Blast (Addgene, 52962) generated from HEK293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV1-hSyn-Cre-WPRE-hGH (Addgene, 10^13 gc/ml, diluted 1:5), AAV5-CAG-FLEX-tdtomato (UNC Viral Core ...
-
bioRxiv - Neuroscience 2022Quote: ... the AAV11 Cap fragment was inserted into pAAV-RC2/1 vector (Addgene, #112862) by T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392); pMDLg/pRRE (gift from Didier Trono ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guide RNA (supplementary table 1) were cloned into pCFD3-dU6:3gRNA (Addgene 49410) digested by BbsI using annealed oligonucleotides ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-hSyn-hChR2-eYFP (UPenn Vector Core AV-1-26973P / Addgene 26973-AAV1) or AAV1-CamKIIa-hChR2-mCherry (UPenn Vector Core AV-1-26975 / Addgene 26975-AAV1 ...
-
bioRxiv - Neuroscience 2021Quote: ... or control virus (AAV8-hsyn-DIO-mCherry) (1×1013 VG/ml; Addgene, 50459) into 3 NBM/SI sites (350 nl/site ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 μg of CS2-plasmid containing the ORF for Cas9 (Addgene #51307) or H2B-RFP was linearized by Not1 endonuclease digestion ...
-
bioRxiv - Microbiology 2021Quote: ... and a plasmid pCMV delta R8.2 encoding HIV-1 GagPol (Addgene, plasmid # 12263) using FuGENE 6 (Promega ...
-
bioRxiv - Bioengineering 2021Quote: ... we injected AAV1-Syn-GCaMP6s-WPRE375-SV40 virus (Addgene, 100843-AAV1, 1×1013) into the visual cortex of the C57BL/6 mice 2-3 weeks before the in vivo imaging experiments ...
-
bioRxiv - Molecular Biology 2020Quote: ... The annealed oligos were diluted (1:200) and cloned into lentiCRISPRv2 (Addgene # 52961) using a Golden Gate Assembly strategy (containing ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Guide RNA (Supplementary table 1) were cloned into pCFD3-dU6:3gRNA (Addgene 49410) digested by BbsI using annealed oligonucleotides (Integrated DNA Technology™) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cloning of shRNAs was conducted according to the pLKO.1 protocol (Addgene 2006). YAP 6SA was subcloned into pLJM1 by PCR amplification using primers (For ...
-
bioRxiv - Neuroscience 2022Quote: The following viruses and were used: AAV2/1-hSyn-flex-ChR2-eYFP (Addgene), AAV-pgk-retro-Cre (Addgene) ...
-
bioRxiv - Neuroscience 2022Quote: ... Cre-dependent GCaMP6f virus (AAV.Syn.Flex.GGaMP6f.WPRE.SV40, Addgene #100833, 1×1012 genome copies per ml) was selectively injected within S1J (jaw ...
-
bioRxiv - Systems Biology 2023Quote: ... 31 were transduced with pLenti PGK V5-luciferase (w528-1) blast (Addgene #19166) and selected with 10 µg/ml blasticidin (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... and further sub-cloned into pLenti CMV Blast DEST (706-1) (Addgene, #17451) (Campeau et al ...
-
bioRxiv - Neuroscience 2023Quote: ... and calcium indicator jRCaMP1b (AAV1.Syn.NES-jRCaMP1b.WPRE.SV40) (Addgene, titer ≥ 1×10¹³ vg/mL) were mixed in a 1:1 ratio and vortexed immediately prior to intracranial infusion surgeries.
-
bioRxiv - Neuroscience 2023Quote: ... ≥ 1 x 1013 vg/mL) or AAV1-Ef1a-DIO eNpHR 3.0-EYFP (Addgene: 26966-AAV1 ...
-
bioRxiv - Biophysics 2023Quote: ... the StuI and XmaI restriction sites in plasmid pENTR4-HaloTag (Addgene #W876-1) were changed into a silent mutation following standard cloning techniques using primers TL-019-TL-020 and TL-023-TL-024 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127) was unilaterally injected in the PVH of MC4R-2A-Cre mice (150 nl ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC55 (Boston Children’s Hospital Vector Core; Addgene 169127) and AAV2/1-hSyn-DIO-GreenDownwardcADDis (Boston Children’s Hospital Vector Core ...
-
bioRxiv - Cancer Biology 2023Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371 ...
-
bioRxiv - Developmental Biology 2023Quote: ... TIR-1 was amplified from plasmid pLZ31 (Zhang et al., 2015) (Addgene #71720) and cloned under control of the hlh-3 promoter in pSL780 (Bone et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... We injected 50-100 nL of AAV (AAV2/1-Syn-jGCaMP8m-WPRE, Addgene #162375 or AAV2/1-Syn--GCaMP6s-WPRE-SV40 ...
-
bioRxiv - Microbiology 2023Quote: ... The human ANP32A 1-149 construct was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ...