Labshake search
Citations for Addgene :
251 - 300 of 2378 citations for 7 Chloro 2 4 bis trifluoromethyl 1 8 naphthyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Pups were injected unilaterally with 1 μl of AAV9-hSyn-DIO-ChrimsonR-mRuby2-ST (2 × 1012 gc ml−1; Addgene #105448) or 1 μl of AAV9-CAG-Flex-ArchT (2 × 1012 gc ml−1 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Neuroscience 2023Quote: ... For transfection, 5 µg of DNA (4:3:1 of a transgene, pCMVdR8.74 (packaging plasmid; Addgene, Plasmid #22036) and pMD2.G (envelope plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg pUMVC (Addgene, 8449) and 18 μg transfer plasmid were mixed in 700 μL DMEM medium (Corning ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected AAV1.Syn-GCaMP6m (pAAV.Syn.GCaMP6m.WPRE.SV40 from Addgene, #100841, titer 6-8 ✕ 1012). To express tdTomato in GABAergic neurons ...
-
bioRxiv - Bioengineering 2024Quote: ... pFA6a-link-yoEGFP-SpHis5 (primers OM-8 and OM-9) (Addgene plasmid #44836), and pBTK522::FAST-PETase 21 (gift from Hal Alper ...
-
bioRxiv - Cell Biology 2022Quote: ... mKeima-Red-Mito-7 plasmid was a gift from Michael Davidson (Addgene plasmid #56018; www.addgene.org/56018). MitoTracker Deep Red FM ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nL total of AAVrg-hSyn-GFP (Addgene 50465-AAVrg; titer 7×10^12 vg/mL) was unilaterally injected at a rate or 2 nL/sec into the mPFC (100 nL in IL ...
-
bioRxiv - Systems Biology 2021Quote: RTK constructs were obtained from three sources: 7 were gifts from William Hahn & David Root (Addgene plasmid # 23914 ...
-
bioRxiv - Cell Biology 2021Quote: ... The following expression constructs were a kind gift from Michael Davidson: eGFP-actin-7 (Addgene #56421), mEmerald-actin-N-10 (Addgene #53979) ...
-
bioRxiv - Neuroscience 2020Quote: ... we intracranially injected 200 nL of AAV5-hSyn-DIO-hM3D(Gq)- mCherry (Addgene, titer: 7 × 1012) into both the left and right BLA at coordinates AP ...
-
bioRxiv - Microbiology 2022Quote: Plasmids used in this study include mEmerald-Mito-7 (a gift from Dr. Michael Davidson (Addgene plasmid # 54160 ...
-
bioRxiv - Neuroscience 2022Quote: [7] GCaMP6s from pGP-CMV-GCaMP6s (a gift from Douglas Kim & GENIE Project, Addgene ID # 40753) (Chen et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... primers 1033F-1038F were individually mixed with primer 1039R and pLdCH plasmid DNA (Addgene #84291, (7)) to amplify an sgRNA expression cassette ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... TG+ controls received identical bilateral infusions of AAV5-hSyn-DIO-mCherry (7×1012 vg / mL; Addgene) and TG-controls received sterile saline.
-
bioRxiv - Neuroscience 2023Quote: ... The virus carried either a red calcium indicator alone (7 mice; jRGECO1a; AAV1.Syn.NES.jRGECO1a.WPRE.SV40; a gift from Douglas Kim & GENIE Project (Addgene plasmid # 100854 ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected a Cre-dependent AAV (AAV5-syn-FLEX-jGCaMP7f-WPRE (Addgene: 7×1012 vg/ml)) in the zona incerta of Vgat-cre mice (Jax 028862 ...
-
bioRxiv - Neuroscience 2024Quote: ... RLAs received AAV5-hSyn-DOI-hM4D(Gi)-mCherry (7×10¹²vg/mL, Addgene, plasmid number 44362). As a control ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV-hSyn-DIO-hM4D(Gi)-mCherry (400 nl at titer 7×1012, Addgene, #44362-AAV5) for inhibition ...
-
bioRxiv - Neuroscience 2023Quote: Anterograde transsynaptic expression was done with AAV1-cre (AAV1.CamKII0.4.Cre.SV40, 7×10¹² vg/mL, Addgene). Retrograde transsynaptic expression was performed with starter vector (AAV-DIO-Ef1a-TVA-FLAG-2A-N2C_G ...
-
bioRxiv - Neuroscience 2024Quote: ... RHAs received AAV5-hSyn-DOI-hM3D(Gq)-mCherry (7×10¹²vg/mL, Addgene, plasmid number 44361). Conversely ...
-
bioRxiv - Neuroscience 2024Quote: ... an anterograde Cre-dependent AAV5-hSyn-DOI-hM4Di-mCherry (7×10¹² vg/mL, plasmid #44362, Addgene) for RLA rats (hM4Di-group ...
-
bioRxiv - Neuroscience 2024Quote: ... or an anterograde Cre-dependent AAV5-hSyn-DOI-mCherry (7×10¹² vg/mL, plasmid #50459, Addgene) for control groups (mCherry control groups ...
-
bioRxiv - Immunology 2024Quote: ... HEK293T cells were transfected with the lentiviral vector pScalps-EGFP-Cre recombinase (7) (Addgene plasmid 207132) together with the packaging vectors psPAX2 and pMD2.G (Addgene plasmids 12260 and 12259 by Didier Trono ...
-
bioRxiv - Immunology 2020Quote: ... the lentiCas9-v2 lentivirus were produced from HEK-293FT cells transfected with the lentiCas9-v2 plasmid mixed at a 2:1:1 DNA ratio of the lentiviral packaging plasmids pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Topbp1 (shTopbp1 #1 and shTopbp1 #2) and a scramble control sequence (shScbl) were cloned into the pLKO.1-Hygro lentiviral vector (Addgene plasmid #24150). The lentiviral-containing medium was harvested from HEK293T cells at 48 h and 72 h after transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of PHGDH plasmid or 4 μg of empty vector plasmid (Addgene, plasmid #52107) was mixed with 4 μg of DNA RV helper plasmid (Addgene ...
-
Rhes protein transits from neuron to neuron and facilitates mutant huntingtin spreading in the brainbioRxiv - Neuroscience 2021Quote: ... The mCherry-HTT N171 18Q or 89Q were cloned in 3rd generation Lentiviral vector for bi-cistronic expression of EGFP and the gene of interest (Addgene, 24129) and transfected in HEK 293T cells along with packaging plasmids ...
-
bioRxiv - Immunology 2020Quote: ... antisense: aaacCAGTGATGTCACCCGTGTGC) were hybridised and ligated into the Bsm BI site of pLentiGuide-Puro (gift from Feng Zhang, Addgene # 52963 (20)) ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Cell Biology 2024Quote: ... and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Neuroscience 2022Quote: - AAV-hSyn-DIO-hM4D(Gi)-mCherry (Addgene 44362 or Zürich VVF v84, serotype 8), here referred to as AAV-DIO-hM4Di-mCherry ...
-
bioRxiv - Immunology 2022Quote: ... and −8 were cloned into the LentiCRISPR v2 plasmid (Feng Zhang, Addgene plasmid #52961). The sequences for the guide RNAs were as follows ...
-
bioRxiv - Cell Biology 2022Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54663 ; http://n2t.net/addgene:54663 ; RRID:Addgene_54663). Vectashield antifade mounting medium (Vectorlabs ...
-
bioRxiv - Neuroscience 2019Quote: Mice 5-7 weeks old received bilateral microinfusion of AAV1-CamKiia-hChR2(H134R)-mCherry.WPRE.hGH (Addgene, #26975-AAV1) layer 2/3 of the barrel cortex (−1.3mmAP ...
-
bioRxiv - Cell Biology 2022Quote: ... The mCh-NLS plasmid was generated by Michael Davidson and obtained from Addgene (mCh-Nucleus-7, #55110). The pericentrin-RFP plasmid (Gillingham & Munro ...
-
bioRxiv - Cancer Biology 2022Quote: ... mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245; http://n2t.net/addgene:54245; RRID:Addgene_54245). pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806 ...
-
bioRxiv - Neuroscience 2020Quote: The alrm-QF2 line was generated by subcloning the enhancer region into pPTQF#7-hsp70 (Addgene# 46136) using EcoRI and BamHI ...