Labshake search
Citations for Addgene :
201 - 250 of 2378 citations for 7 Chloro 2 4 bis trifluoromethyl 1 8 naphthyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... gene targeting sgRNAs (Supp Table 7) were cloned into pX459 (Addgene plasmid #48139) using BbsI (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Genetics 2019Quote: pCFD3-frame_selector_(0, 1, or 2) plasmids (Addgene #127553-127555, DGRC #1482-1484) were cloned by ligating annealed oligos encoding sgRNAs that target the CRISPaint target site (Schmid-Burgk et al ...
-
bioRxiv - Neuroscience 2021Quote: ... 500–550 nl of AAV9-Syn-jGCaMP7f-WPRE virus (diluted 1:2; Addgene) was injected in dorsal CA1 to express synapsin-driven calcium sensor jGCaMP7f (injection coordinates ...
-
bioRxiv - Cell Biology 2022Quote: ... 1–2 (lenti-TRE3G-ApaLI(*)-Hygro) were cloned into LT3REVIR (Addgene Plasmid #111176) by inserting mito-ApaLI(* ...
-
bioRxiv - Neuroscience 2023Quote: ... diluted to 1/2) or AAV-Ef1a-mCherry (#114470-AAV9, obtained from Addgene; titer ...
-
bioRxiv - Cell Biology 2023Quote: ... YAP-targeting shRNA vectors 1 and 2 refer to pLKO1-shYAP1 (Addgene, #27368) and pLKO1-shYAP2 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.50 µL of AAV5.FLEX.ArchT.tdTomato (diluted 1:2 with dPBS; Addgene number: 28305) was injected in basal forebrain of ChAT-Cre animals using the coordinates described above ...
-
bioRxiv - Neuroscience 2021Quote: stGtACR2: 300 nL 1:10 AAV2/8-hSyn1-SIO-stGtACR2-FusionRed (working concentration 4.7*1011 gc/mL, Addgene/Janelia Viral Core, Ashburn, VA)
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Physiology 2021Quote: ... Adeno-associated viruses with a null vector (Addgene, AV-8-PV0148) were used as controls.
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Neuroscience 2024Quote: ... The he1.1:YFP cassette (he1.1:YFP_F, he1.1:YFP_R, Table 4) was amplified from p3E_he1a:YFP (Addgene, plasmid #113879), and the polyA terminator (polyA_F ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737; http://n2t.net/addgene:105727; RRID:Addgene_105727) (gift from Hilal Lashuel).
-
bioRxiv - Neuroscience 2022Quote: ... we injected AAV1-CAG-FLEXFRT-ChR2(H134R)-mCherry (75470, 7×1012 vg/mL, Addgene). For imaging DA dynamics ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Cell Biology 2019Quote: ... mEmerald-Vimentin-7 and F-tractin-EGFP were gifts from Michael Davidson (Addgene; 54299) and Dr ...
-
bioRxiv - Biophysics 2022Quote: ... mApple-Lifeact-7 (denoted Lifeact-mApple here) was a gift from Michael Davidson (Addgene plasmid # 54747 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Nslmb-vhhGFP4 coding sequence was amplified from pcDNA3-NSlmb-vhhGFP4 (Addgene plasmid #35579, (7)) by PCR and cloned into pCS2+ plasmid by Gibson assembly.
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-eGFP (titer ≥ 7×1012 vg/mL; Addgene viral prep #50465-AAV5) as control ...
-
bioRxiv - Microbiology 2022Quote: Several plasmids were a kind gift from Nevan Krogan [7] (ORF8-Strep (Addgene #: 141390), Spike-Strep ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 0.2uL of pAAV5-hSyn-hM4D(Gi)-mCherry (≥ 7 x 1012vg/mL, Addgene # 50475), pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Bioengineering 2023Quote: ... An existing plasmid was used for the expression of all 7 chaperones (Addgene #197589). For generating the DRUM or DRUMmut stable cell lines ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV-hSyn-DIO-mCherry (400 nl at titer 7×1012, Addgene, #50459-AAV5) as control ...
-
bioRxiv - Cancer Biology 2022Quote: 293T cells were transfected with packaging plasmids (8 μg of pCMV-dR8.2 dVPR and 1 μg pCMV-VSV-G, a gift from Robert Weinberg, Addgene plasmid #8455 and 8454, respectively) along with shRNA plasmids (8 μg ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR products and a pCS2+8 vector (Gokirmak et al., 2012) (Addgene) were digested with XbaI and BamHI (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-DIO-hM4D(Gi)-mCherry (≥8 × 1012vg/mL, Addgene #44362). The needle remained in place for an additional 5 minutes after each injection to allow for diffusion of the virus and then the needle was slowly removed from the brain ...
-
bioRxiv - Neuroscience 2024Quote: ... rAAV5-hsyn-mCherry-WPRE (Addgene #114472, Titer: 8 x 1012 GC/mL) was injected unilaterally (60-100 nL at 40 nL/min ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 8 hSyn-DIO-mCherry (2.2 × 1013 gp/mL) (Addgene #50459)
-
bioRxiv - Neuroscience 2021Quote: ... 200 nL of AAVrg-hSyn-GFP (Addgene 50465-AAVrg; titer 7×10^12 vg/mL) was injected unilaterally at a rate of 2nL/sec ...
-
bioRxiv - Neuroscience 2022Quote: ... or pAAV-hSyn-DIO-mCherry (Control mCherry reporter; Addgene #50459, titers: 7×1012 vg/ml) into the VTA ...
-
bioRxiv - Cell Biology 2020Quote: ... the GFP11x7 cassette was PCR amplified from pACUH:GFP11×7-mCherry-beta-tubulin (Addgene, plasmid # 70218), and integrated at the 5’ end of the SHE1 open reading frame using the sequential URA3 selection/5-FOA counterselection method ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-hSyn-hM4D(Gi)-mCherry (serotype AAV retrograde, viral titer ≥ 7×1012 vg/mL; Addgene), and Clozapine N-oxide (CNO ...
-
bioRxiv - Cell Biology 2023Quote: Expression constructs used in this study include pCI-mScarlet (Addgene #85042; pC1-mScarlet-Syp [7]), pCIG2-GFP-MACF43 [42] ...
-
bioRxiv - Genomics 2023Quote: ... 7 μg of pUCmini-iCAP-PHP.eB (a gift from Viviana Gradinaru, Addgene plasmid #103005, RRID:Addgene_103005)24 ...
-
bioRxiv - Genomics 2023Quote: ... 7 μg of pUCmini-iCAP-PHP.eB (a gift from Viviana Gradinaru, Addgene plasmid #103005, RRID:Addgene_103005)24 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; virus titer ≥ 7×10¹² vg/mL) viruses were performed on adult anesthetized (isoflurane ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV-hSyn-DIO-hM3D(Gq)-mCherry (400 nl at titer 7×1012, Addgene, #44361-AAV5) for activation ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.1 µL of AAV2-pCAG-FLEX-eGFP (Addgene #51502; titer: 7×10¹² vg/mL) was injected into the SNr during the same surgery ...