Labshake search
Citations for Addgene :
301 - 350 of 2201 citations for 7 16 DIHYDROBENZO A BENZO 5 6 QUINO 3 2 I ACRIDINE 9 18 DIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... NM_007553.2) and subsequently subcloned into pENN.AAV.cTNT.PI.eGFP.WPRE serotype 9 adenoviral vector (Addgene, Cat.: #105543). A modified protocol from Wakimoto et al ...
-
bioRxiv - Developmental Biology 2021Quote: ... trans-plasmid encoding AAV replicase and capsid gene pAAV2/9 (Addgene, Cat.:112865) and either pAAV-cTnT-GFP (vehicle ...
-
bioRxiv - Developmental Biology 2021Quote: DR274 gRNA plasmids and Cas 9 protein were from Addgene (Cambridge Massachussets, USA) and New England Biolabs (Ipswich ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9-EF1a-DIO-EYFP viral particles (0.8μl; 1013 GC/ml; Addgene #27056) were injected bilaterally into the CA1 hippocampus (coordinates relative to bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL, Addgene, 108685) was injected into the MLT (from the bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... and chemogenetic experiments: AAV1/9 CAG FLEX GCaMP6f (titre 1.9x1013, Addgene # 100836-AAV1), AAV9.CamKII.GCaMP6s (titre ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 nL of AAV2/9-hSyn-GCaMP6s (Addgene, titer ≥ 1×1013 vg/mL) was pressure injected into each ocular vitreous through a glass micropipette using a Nanoject (Drumond Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: ... pFA6a-link-yoEGFP-SpHis5 (primers OM-8 and OM-9) (Addgene plasmid #44836), and pBTK522::FAST-PETase 21 (gift from Hal Alper ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cell Biology 2019Quote: ... and Firefly Luciferase (5’-TGAAGTCTCTGATTAAGTA-3’) were cloned into the HpaI and XhoI restriction sites in pSICOR (Addgene RRID:Addgene_11579) (Ventura et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-AAACGGGATGCAGGGATGTCGACTc-3’) and cloning this into the unique BbsI sites of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene # 42230), modified by the addition of a PGK-Puro cassette.
-
bioRxiv - Plant Biology 2023Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 x 105 HeLa cells were seeded into a 6-well plate and next day transfected with 2 μg of the FLPe recombinase plasmid (Addgene #20733) (Beard et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Systems Biology 2019Quote: ... 350k HAP1 WT cells were seeded into a 6-well plate and 24 hours later cells were transfected with a mix of 2 µg pX459 plasmid (Addgene #62988) carrying a gRNA ...
-
bioRxiv - Genetics 2020Quote: ... a single guide sequence (primers JBW0001/2) targeting MSH2 exon 6 was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) as described24 ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Biophysics 2019Quote: ... mTagRFP-T-Mito-7 (mTagRFP-mito, Addgene plasmid # 58023) were gifts from Michael Davidson ...
-
bioRxiv - Neuroscience 2020Quote: ... titer value ≥ 7×1012 vg/ml (Addgene, #59462-AAVrg).
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and pACUH-GFP11×7-mCherry-α-tubulin (Addgene: 70218)39.
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: ... plasmid and another population with mEGFP-lifeact-7 (Addgene #58470 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL, Addgene # 114472) or AAVrg-hSyn-Cre (≥ 1.8 x 1013 vg/ml ...
-
bioRxiv - Physiology 2019Quote: ... Plasmids encoding the sensors Laconic 18 and Pyronic 19 are available from Addgene (www.addgene.org). Ad Laconic and Ad Pyronic (serotype 5 ...
-
bioRxiv - Microbiology 2024Quote: ... pHelper and pAAV-2.5 capsid plasmids were used (Addgene and (16). For VLP production ...
-
bioRxiv - Cell Biology 2020Quote: ... designed by Life technologies to target the second exon of murine Vangl2 (gRNA: 5’-TCGGCTATTCCTACAAGTC-3’) into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138). Upon transfection ...
-
bioRxiv - Molecular Biology 2020Quote: The gRNA sequence: 5’-TTAAAGAGTAACTACCAACT-3’ targeting the mouse Xpo7 gene was cloned into the PX459 plasmid (Addgene #62988, (23)) ...
-
bioRxiv - Genomics 2020Quote: ... and a revers primer (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-GTGTCTCAAGATCTAGTTACGCCAAGC-3′) were used to amplify 222 bp fragments from CROPseq-Guide-Puro plasmids (#86708, Addgene) which have been inserted with different gRNA sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Ring1b (5’-ACAAAGAGTGTCCTACCTGT -3’) were introduced into a modified version of the vector plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230) that yields a BFP marker for selection (Gift by J ...
-
bioRxiv - Microbiology 2019Quote: ... full length VPA0226 was amplified using primers 3’ GATC AGATCT ATGATGAAAAAAACAATCACACTA 5’ and 5’ GATA GAATTC G GAAACGGTACTCGGCTAAGTTGTT 3’ and cloned in frame with GFP into the expression vector sfGFP-N1 (41) (Addgene) between BglII and EcoRI sites for the expression of C terminally tagged VPA0226 ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA (sgRNA) targeting exon 4 of TP53 (5’-CTGTCATCTTCTGTCCCTTC-3’) was cloned into pSpCas9(BB)-2A-GFP (pX458, plasmid #48138, Addgene). pSpCas9(BB)-2A-GFP was a kind gift from dr ...
-
bioRxiv - Cell Biology 2021Quote: ... the fragments of 5’ and 3’ homology arms to target ROSA26 locus were subcloned into H2B-670 (modified from pmiRFP670-N1, #79987, Addgene) or FUCCI (kind gift from Ludovic Vallier’s lab ...
-
bioRxiv - Cell Biology 2021Quote: ... the fragments of 5’ and 3’ homology arms to target AAVS1 locus were subcloned into hOCT4 promoter containing phOCT4-EGFP plasmid (#38776, Addgene) using AAVS1 SA-2A-puro-pA donor plasmid (#22075 ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragments of 5’ and 3’ homology arms of ORACLE-OCT4 (exo) were replaced using human OCT4-2a-eGFP-PGK-Puro (#31938, Addgene) to target endogenous OCT4 locus with modification ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reverse: 5’-AAAC-(N)19-20-3’) were designed and cloned in a zebrafish U6 promoter-driven vector (Addgene#64245) at BsmBI restriction sites according to the previous study (Jao et al. ...
-
bioRxiv - Genetics 2022Quote: ... with 5’ KpnI and 3’ EcoRI sites (primers LC127 and 128) into the corresponding restriction digestion sites of pLP9 (Addgene plasmid #1497 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hcas9 (a gift from George Church; Addgene plasmid # 41815 ...
-
bioRxiv - Biochemistry 2020Quote: ... we used plasmids encoding hDicer 3’-pocket double mutant (Y926F, R927A), and the 5’-pocket sextuple mutant (R778A, R780A, R811A, H982A, R986A, R993A) (23) (Addgene). PCR fragments were subsequently cloned into the pMCSG7 vector (courtesy of Laboratory of Protein Engineering ...
-
bioRxiv - Immunology 2021Quote: ... the short guide RNAs (sgRNAs) targeting the signaling peptide (5’-GAGTAGCGCGAGCACAGCTA - 3’) was cloned into lentiCRISPR v2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Immunology 2022Quote: ... HHLA2 cDNA included 5’ EcoRI and 3’ NotI sites and was cloned into the pBMN-IRES-GFP vector (Addgene #1736). PCR (Q5 enzyme ...
-
bioRxiv - Cell Biology 2023Quote: ... The PAC sgRNA (5′-TGTCGAGCCCGACGCGCGTG-3′) (Lambrus et al., 2016) was cloned into the pSpCas9(BB)-2A-GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’ ...
-
bioRxiv - Neuroscience 2023Quote: Ntsr1-Cre mice (n = 3) were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO- stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” 6 weeks prior to the recordings ...
-
bioRxiv - Developmental Biology 2023Quote: ... The guide sequence used was 5’-TCTCTGAGTGCCAACGCGCG-3’ and was cloned into the BbsI site of pX459 vector (Addgene #62988). The gene targeting was performed by co-transfection of pX459 and the synthetic donor vector into B6N 6.0 embryonic stem cells using Lipofectamine 2000 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...