Labshake search
Citations for Addgene :
451 - 500 of 2201 citations for 7 16 DIHYDROBENZO A BENZO 5 6 QUINO 3 2 I ACRIDINE 9 18 DIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Developmental Biology 2021Quote: ... cloning to insert SOX9 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP plasmid (a gift from Janet Rossant, Addgene plasmid # 112851). AAVS1 repair template was created by Infusion cloning to swap the CAG promoter and Puromycin resistance cassette in plasmid AICSDP-42 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX2 knockout repair template was created by Infusion cloning to insert SOX2 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP (a gift from Janet Rossant, Addgene plasmid # 112851). SFTPC targeting repair template was created by Infusion assembly of SFTPC 5’ and 3’ homologous arms together with T2A-Rox-EF1a-Rox-Venus-NLS ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesized IRIS guide RNA oligonucleotide (target sequence: 5’-CTGGGGCAAACACAAAAACCTGG-3’) was cloned into the BsmB1 sites of the lentiCRISPRv2 vector (a gift from Feng Zhang, Addgene plasmid #52961)50 following the protocol described by Sanjana et al.50 ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... Injection mix consisted of 0.5pmol/ul in vitro transcribed RNA and 2.5ng/ul co-injection marker (pmyo-2::mCherry::unc-54 3’UTR) plasmid pCFJ90 (Addgene, plasmid #19327), dissolved in water ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Developmental Biology 2023Quote: Two gRNAs were designed to target the exon 3 of REV1 (Supplementary Table 2) and subcloned into the PX458 plasmid (Addgene, 48138). 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... oligos encoding guide RNAs targeting intron 2 and intron 3 of murine Dyrk1a were cloned into plasmid pX459 v2.0 (Addgene plasmid # 62988) and sequence verified ...
-
bioRxiv - Cell Biology 2023Quote: ... the nucleotide sequence of pEGFP-Mieap between the Nhe I and Xho I restriction sites containing EGFP was replaced with nucleotide sequence of pTagRFP-T-EEA1 (Addgene #42635) between the Nhe I and Xho I restriction sites containing TagRFP-T ...
-
bioRxiv - Cell Biology 2019Quote: ... mRuby-Lifeact-7 was a gift from Michael Davidson (#54560, Addgene). One day after transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-Ef1α-mCherry-IRES-Cre (Titer ≥ 7×1012 vg.mL−1, Addgene). Cholera Toxin Subunit B (Recombinant) ...
-
bioRxiv - Neuroscience 2020Quote: rAAV5-hSyn-hChR2(H134R)-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-Jaws-KGC-GFP-ER2 (Titer ≥ 3.8×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-Ef1α-DIO-hChR2(H134R)-eYFP (Titer ≥ 4.2×1012 vg.mL−1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and EBFP2-Nucleus-7 (Addgene #55249, a gift from Michael Davidson). The targeting sequences for the nucleus ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-AAV-CAG-tdTomato (Addgene, 7×10^12 gc/ml), Cholera toxin subunit B CF-640 (Biotium ...
-
bioRxiv - Cell Biology 2020Quote: ... and mCherry-Cx43-N-7 were gifts from Michael Davidson (Addgene plasmids # 55112 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Lifeact-7 was a gift from Michael Davidson (Addgene, 54491).
-
bioRxiv - Cell Biology 2022Quote: ... The mCherry-EB3-7 vector was obtained from Addgene (addgene #55037) and the mCherry was removed and replaced by a GFP sequence using AgeI/BsrG1 restriction enzymes ...
-
bioRxiv - Neuroscience 2023Quote: ... mKeima-Red-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56018 ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669, 7 × 1012 VG/ml) were made unilaterally into right spinal cord gray matter at C7/C8 (0.5 mm lateral ...
-
bioRxiv - Neuroscience 2023Quote: ... 7×10¹² genome copies per ml) viruses were purchased from Addgene.
-
bioRxiv - Synthetic Biology 2021Quote: ... the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234 ...
-
bioRxiv - Neuroscience 2021Quote: ... under a flex promoter was obtained from the University of Pennsylvania Vector Core (AAV2/9.Syn.Flex.GCaMP6f.WPRE.SV40, CS0641, Penn Vector Core via Addgene). Lateral septum viral injections were targeted at the following coordinates ...
-
bioRxiv - Microbiology 2020Quote: ... CRISPR/Cas-9 vectors were derived from the plasmid lentiCRISPRv2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2019Quote: ... 5.2×1012 gc/ml) and AAV2/5-hSyn-DIO-hM3Dq-mCherry (7.8×1012 gc/ml) were produced from Addgene plasmids #44362 and #44361 at the facility of Nantes University (UMR 1089 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 370 bp fragment of genomic DNA containing miRNA miR-34c was cloned into the Xho I and Mlu I restriction sites of the pLKO.1 vector (Addgene plasmid #52920) to express miR-34c (32) ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Cell Biology 2019Quote: ... NOX1 and NOX2 deletion constructs were generated by inserting PCR amplified 5’ UTR and 3’ UTR fragments of the target genes sequentially into backbone vector pFGL821 (Addgene #58223, hygromycin resistance), flanking the HPH (hygromycin B phosphotransferase ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Microbiology 2020Quote: ... was made from the XLone-GFP parental plasmid which was a gift from Xiaojun Lian 18 (Addgene plasmid # 96930 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pcDNA3.1-FLAG-SF3B1-WT and pcDNA3.1-FLAG-hSF3B1-K700E (18) were obtained from Addgene (#82576 and #82577). The human full-length SF3B1 sequence has been previously reported to be impossible to clone into bacteria (59,60) ...
-
bioRxiv - Neuroscience 2020Quote: ... The mScarlet-I sequence (based on Addgene Plasmid #85068) was codon-optimized (IDT ...
-
bioRxiv - Cell Biology 2020Quote: ... and mScarlet-I (Addgene #85044, gift from Dorus Gadella). Plasmids for CRISPR-based knockout were constructed using pMCB320 (Addgene #89359 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Genomics 2021Quote: ... and pMD2.G (Addgene, 12259, 6 µg) using calcium phosphate precipitation (62) ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 μg pSAD-∆G-F3 (Addgene, 32634) with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene ...