Labshake search
Citations for Addgene :
301 - 350 of 2604 citations for 6H 5 Oxa 1 2a 4a triazacyclopenta cd pentalene 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138 ...
-
bioRxiv - Cell Biology 2020Quote: Oligo duplexes containing a single guide (sg)RNA sequence for ACLY (as shown in Figure 1-figure supplement 1A) were inserted into pCas9(BB)-2A-GFP (a gift from Feng Zhang, Addgene #48138) following the published procedures (Ran et al. ...
-
bioRxiv - Molecular Biology 2023Quote: Two oligos H3F3AN-1-73F CACCGTCAATGCTGGTAGGTAAGTA and H3F3AN-1-73R AAACTACTTACCTACCAGCATTGAC containing gRNA sequence were annealed and inserted into pSpCas9-2A-Puro vector (PX459, Addgene # 62988), digested with BbsI-HF enzyme (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... MDA-MB-231 cell line stably expressing Flag–Rab40b-4A was created by cloning Rab40b-4A (primers purchased from IDT, Coralville, IA) into lentiviral pCS2-FLAG vector obtained from Addgene (Cambridge, MA). Cell lines were routinely tested for mycoplasma ...
-
bioRxiv - Molecular Biology 2023Quote: ... The CDS for AGO1 and GW182 were PCR amplified from pAFW-Ago1 (Addgene #50553) and LD47780 (DGRC ...
-
bioRxiv - Molecular Biology 2019Quote: ... vector pSpCas9(BB)-2A-Puro (PX459) V2.0 (a gift from Feng Zhang, Addgene plasmid #62988 ...
-
bioRxiv - Immunology 2021Quote: ... The pSpCas9(BB)-2A-GFP (PX458) vector was purchased from Addgene (plasmid # 48138). RNA guide sequences targeted to the SHP-1 locus and for knock-in of the S591D mutation were constructed using an online CRISPR design tool (Zhang Lab).
-
bioRxiv - Molecular Biology 2020Quote: ... pSpCas9n(BB)-2A-GFP (PX461) (Addgene plasmid # 48140; http://n2t.net/addgene:48140; RRID:Addgene_48140). The gRNA/Cas9 plasmid and repair template plasmid were transfected into HeLa cells as described above ...
-
bioRxiv - Molecular Biology 2021Quote: The pSptCas9(BB)-2A-Puro(PX459)-V2.0 vector was obtained from Addgene (#62988) and the sgRNA was designed using the CRISPOR online tool (http://crispor.tefor.net/crispor.py) ...
-
bioRxiv - Molecular Biology 2019Quote: The pSptCas9(BB)-2A-Puro(PX459)-V2.0 vector was obtained from Addgene (#62988) and sgRNAs were designed using the CRISPOR online tool (http://crispor.tefor.net/crispor.py) ...
-
bioRxiv - Bioengineering 2019Quote: ... and were cloned into the OCT4-2A-eGFP donor plasmid (Addgene plasmid #31938). Two sgRNAs targeting at or near T stop codon (1 ...
-
bioRxiv - Genetics 2021Quote: ... Sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene #62988 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pSpCas9n(BB)-2A-Puro (PX462) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62987 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were cloned into the pSpCas9(BB)-2A-Puro plasmid (PX459, v2.0; Addgene, #62988), transfected in PDA cell lines ...
-
bioRxiv - Neuroscience 2020Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Cancer Biology 2021Quote: ... All sgRNAs used were cloned in pSpCas9(BB)-2A-GFP (plasmid 48138, Addgene). The sgRNAs were transfected into DIPG cells using Lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The guide RNA was cloned into PSpCas9 (BB)-2A-GFP(PX458) (Addgene, 48138) following protocol from Ran et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNAs were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988). To Make KO ...
-
bioRxiv - Immunology 2022Quote: ... to enable annealing into the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138). A549 cells were transfected with PX458-containing plasmids and single-cells sorted by GFP positivity to generate clonal knockout (KO ...
-
bioRxiv - Neuroscience 2021Quote: ... UNC Vector Core) and AAV-hSyn-FLEx-mGFP-2A-Synaptophysin-mRuby (Addgene:71760) were used.
-
bioRxiv - Molecular Biology 2022Quote: ... The gRNAs were cloned into pSpCas9 (BB)-2A-puro (pX459) (Addgene, Cat. 62988). The gRNA sequences were 5’ GGATACTATTCAAGTCATCTGGG 3’ (gRNA1 ...
-
bioRxiv - Cell Biology 2022Quote: ... The sgRNA was cloned in the pSpCas9(BB)-2A-GFP plasmid (Addgene, #48138). Then ...
-
bioRxiv - Neuroscience 2019Quote: ... gRNA was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988), which contains a puromycin cassette to facilitate selection of transfected cells ...
-
bioRxiv - Genomics 2019Quote: ... oligonucleotides encoding guide sequences were cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene). The resulting plasmid (2 μg Smarcc2_g1 or g2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The pSpCas9(BB)-2A-Puro(PX459)-V2.0 vector was obtained from Addgene (#62988). sgRNAs were designed using the CRISPOR online tool (http://crispor.tefor.net/crispor.py ...
-
bioRxiv - Molecular Biology 2020Quote: The pSptCas9(BB)-2A-Puro(PX459)-V2.0 vector was obtained from Addgene (#62988) and sgRNAs were designed using the CRISPOR online tool (http://crispor.tefor.net/crispor.py) ...
-
bioRxiv - Cell Biology 2020Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Molecular Biology 2020Quote: NLS-Cas13d-NLS was amplified from pXR001: EF1a-CasRx-2A-EGFP (Addgene # #109049) using primers ...
-
bioRxiv - Molecular Biology 2020Quote: CBP sequences were cloned into the pAC94-pmax-dCas9VP160-2A-puro vector (Addgene: 48226 ...
-
bioRxiv - Genomics 2021Quote: ... and donor plasmid pEN396-pCAGGS-Tir1-V5-2A-PuroR TIGRE (Addgene plasmid #92142) (Nora et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... the puromycin resistance gene in pSpCas9(BB)-2A-Puro (PX459; Addgene plasmid #62988)61 was replaced by either mCherry or iRFP670 using PCR and fragment assembly ...
-
bioRxiv - Microbiology 2021Quote: ... 600 ng of the lentiviral transfer vector pLenti_CMV-EGFP-2A-mNeonGreen (Addgene # 171599), and 600 ng of various viral envelope plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... with the pSpCas9(BB)-2A-GFP plasmid (Cat# 48138, Addgene, Cambridge, MA, USA) according to the manufacturer’s instructions (34) ...
-
bioRxiv - Cell Biology 2020Quote: ... program X-005 with the pSpCas9(BB)-2A-Puro (PX459) vector (Addgene, #62988) bearing the appropriate targeting sequence (KIF21B ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pCW57-GFP-2A-MCS plasmid was a gift from Adam Karpf (Addgene plasmid # 71783 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gene-specific gRNAs were integrated into pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138) and 2 μg of plasmid was electroporated into 106 cells using a Lonza 4D-NucleofectorTM according to the manufacturer’s protocol for HCT116 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid #62988 ...
-
bioRxiv - Cell Biology 2021Quote: ... The pSpCas9 (BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138 ...
-
bioRxiv - Cell Biology 2022Quote: ... pSpCas9(BB)-2A-GFP was a gift from Feng Zhang (Addgene plasmid #48138). pSpCas9(BB)-2A-mCherry was constructed by replacing GFP with mCherry ...
-
bioRxiv - Neuroscience 2022Quote: ... AAACCTGAGCCCGCGACCACACCC –bottom for Sox21NHEJ5) were cloned into pSpCas9(BB)-2A-Puro (px459; Addgene) and designated the plasmid as pX459-Sox21NHEJ4 and pX459-Sox21NHEJ5 ...
-
bioRxiv - Cell Biology 2023Quote: CRISPR-Cas9 plasmids were as follows: pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene 62988 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pLdCH-hyBE4max (Figure 2A) was generated by amplifying hyBE4max (Addgene #157942, (38)) using primer 1008F and 1007R and cloning it into AgeI and FseI sites of pLdCH (Addgene #84291 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9: plenti-EF1a-Cas9-2A-blast and pXPR047 (Cas9-GFP reporter, Addgene# 107145) plasmids were provided by Dr ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene # 62988). Both donor and sgRNA plasmids for SIX2 reporter knockin were transfected into the H1 hESCs using the Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pSpCas9 (BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988, Addgene, Teddington, UK) was modified by an EF1alpha promoter25 ...
-
bioRxiv - Genomics 2023Quote: ... This gRNA was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) via the Zhang lab protocol (https://media.addgene.org/data/plasmids/62/62988/62988-attachment_KsK1asO9w4owD8K6wp8.pdf) ...
-
bioRxiv - Cell Biology 2022Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...