Labshake search
Citations for Addgene :
51 - 100 of 1243 citations for 6 chloro 9H 3 C methyl β D ribofuranosyl purine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... DoubleCatcher β-Lock (GenBank and Addgene deposition in progress), DoubleCatcher γ-Lock (GenBank and Addgene deposition in progress) ...
-
bioRxiv - Genetics 2022Quote: ... pENTR/D-CreERT2 (Addgene#27231)(Mosimann et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequence for L7-6 was obtained from pAAV/L7-6-GFP-WPRE (Addgene plasmid #126462) and ordered as a gBLOCK (IDT) ...
-
bioRxiv - Neuroscience 2019Quote: ... and β-arrestin 1-FLAG (#14687) were obtained from Addgene.
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319 ...
-
bioRxiv - Developmental Biology 2021Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6 μg of psPAX2 (12260; Addgene), and 3 μg of pVSVg (8454 ...
-
bioRxiv - Microbiology 2022Quote: ... 6 µg PMD2.G (Addgene, 12259), 18µg PsPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 μg, Addgene plasmid # 12260) and pAdVAntage (3 μg ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg pMD2.G (Addgene, 12259), 4 μg pUMVC (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Cell Biology 2021Quote: ... and GFP-EPLIN-β-were purchased from Addgene (50529, 40948, 40947). For Flag-Rab40b-4A mutants were generated from an existing PLVX-FLAG-Rab40b plasmid [17] ...
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Genomics 2021Quote: ... and pMD2.G (Addgene, 12259, 6 µg) using calcium phosphate precipitation (62) ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 μg pSAD-∆G-F3 (Addgene, 32634) with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene ...
-
bioRxiv - Pathology 2021Quote: ... and 6 μg pMD2.G (Addgene 12259) or pEC120-S-D19-V5 ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Synthetic Biology 2021Quote: ... β-arrestin 2 was amplifying from pCDNA3.1(+)-CMV-bArrestin2-TEV (Addgene #107245) with Gibson Assembly primers compatible with the NEBuilder HiFi DNA Assembly Kit (New England BioLabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used a TGF-β reporter plasmid pSBE4-Luc (Addgene, plasmid #16495). This plasmid contains four tandem copies of the Smad binding sites ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin plasmid constructs were purchased from Addgene (FLAG-β-catenin WT (Addgene plasmid #16828; http://n2t.net/addgene:16828; RRID:Addgene_16828), FLAG-β-catenin K49R (Addgene plasmid # 44750 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin K49R (Addgene plasmid # 44750; http://n2t.net/addgene:44750; RRID:Addgene_44750), FLAG-β-catenin K19R (Plasmid #Addgene plasmid # 44749 ...
-
bioRxiv - Microbiology 2019Quote: ... The pUPRT::DHFR-D (Addgene, Cat#58528) plasmid backbone with PCR-amplification to remove the DHFR cassette was used to generate the construct for making the GRA45 complementation ...
-
bioRxiv - Bioengineering 2021Quote: ... the sequence encoding the PE2 C terminus (PE2-C term) (Addgene #132775), and the WPRE sequence (Addgene #52962 ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... human c-MYC (RRID:Addgene_17220) and ESRG (6 μg each ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Cell Biology 2020Quote: ... and envelope (6 μg pMD2.G, Addgene #12259) viral plasmids were diluted in 500 μL serum-free DMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 μg of psPAX2 (Addgene, Cat #12260) into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... pLenti c-Jun was created by cloning human c-Jun from PMIEG3-c-Jun (a gift from Alexander Dent (Addgene plasmid #40348)[50] using BAMHI and XHOI into pLenti-puro (a gift from Ie-Ming Shih (Addgene plasmid #39481 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2020Quote: ... FLAG-Axin1 (#109370) and FLAG-β-TrCP (#10865) plasmids were obtained from Addgene. The KIF2A-phospho-mutant (KIF2A S100A ...
-
bioRxiv - Biochemistry 2021Quote: ... PKC plasmids (PKCα, β, γ, δ, ε and θ) were obtained from Addgene, and their coding sequences were subcloned into the pcDNA3.1 vector containing the Flag epitope tag ...
-
bioRxiv - Neuroscience 2021Quote: ... pLL3.7-GFP was a gift from Luk Parijs β (Addgene plasmid # 11795; RRID:Addgene_11795) (Rubinson et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... pLL3.7-GFP was a gift from Luk Parijs β (Addgene plasmid # 11795; RRID:Addgene_11795) (Rubinson et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin K19R (Plasmid #Addgene plasmid # 44749; http://n2t.net/addgene:44749; RRID:Addgene_44749), FLAG- β-catenin K19R/K49R(Addgene plasmid #44751 ...